![]() |
Polyphenol oxidase genes from potato tuber, grape, apple and broad beanNo:6936748 -Application no:08182045 -Filed date:1992-07-16 -Issue date:2005-08-30Kind:B1Claims:38Drawing sheets:15Abstract:A DNA sequence including a gene coding polypeptide having polyphenol oxidase (PPO) activity, or a fragment thereof. US Classes:Inventors:Agents:Assignees:Claims:What is claimed is: 1. An isolated DNA comprising nucleotides having a sequence coding for a polypeptide having polyphenol oxidase (PPO) activity, wherein said sequence corresponds to a nucleotide sequence of DNA from a plant selected from the group consisting of grapevine, apple, and broad bean, a nucleotide sequence of DNA from potato selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13; or a nucleotide sequence encoding an amino acid sequence selected from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14. 2. The isolated DNA according to claim 1 further comprising a pre-sequence of a plant PPO gene coding for a transit peptide. 3. An isolated nucleic acid comprising the isolated DNA of claim 1 operably linked to a nucleotide sequence coding for a targeting sequence wherein said targeting sequence directs the polypeptide encoded by said isolated DNA to a cellular compartment. 4. An isolated nucleic acid comprising the isolated DNA of claim 1 operably linked to a nucleotide sequence encoding a chloroplast transit peptide, wherein said isolated DNA encodes a mature grapevine PPO polypeptide having an amino acid sequence as set forth in SEQ ID NO: 1, or a fragment thereof having PPO activity in grapevine plants. 5. A method for preparing a recombinant DNA plasmid comprising DNA coding for a polypeptide having PPO activity in a plant tissue, which method comprises providing a) DNA comprising nucleotides having a sequence coding for the polypeptide, wherein said sequence corresponds to a nucleotide sequence of DNA from a plant selected from the group consisting of grapevine, apple, and broad bean, a nucleotide sequence of DNA from potato selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13; or a nucleotide sequence encoding an amino acid sequence selected from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14; and b) a plasmid expression vector; and reacting the DNA and the plasmid expression vector to deploy the DNA within the plasmid expression vector, thereby preparing a recombinant DNA plasmid comprising DNA coding for a polypeptide having PPO activity in a plant tissue. 6. The method according to claim 5, wherein the DNA coding for a polypeptide having PPO activity is formed from polyadenylated RNA isolated from the plant. 7. The method according to claim 6, further comprising the steps of providing a source of a polypeptide having PPO activity; isolating polyadenylated RNA coding for the polypeptide having PPO activity therefrom; and treating the polyadenylated RNA to construct copy DNA (cDNA). 8. The method according to claim 7, wherein the step of treating polyadenylated RNA comprises the steps of treating the polyadenylated RNA with reverse transcriptase and an adapter primer to form first strand cDNA; and amplifying the cDNA so formed using the polymerase chain reaction (PCR). 9. The method according to claim 8, wherein the adapter primer is an oligonucleotide adapter having the sequence 5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT (SEQ ID NO:15). 10. The method according to claim 8, wherein the step of amplifying the cDNA is performed with an adapter primer having the sequence 5'-GACTCGAGTCGACATCG (SEQ ID NO: 16) and a 5'-end primer, and wherein the 5'-end primer has a sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: 17 when the polyadenylated RNA is isolated from grapevine; the sequence set forth in SEQ ID NO: 18 when the polyadenylated RNA is isolated from broad bean; the sequence set forth in SEQ ID NO: 19 when the polyadenylated RNA is isolated from apple; and a sequence selected from the group consisting of SEQ ID NO: 20 and SEQ ID NO: 21 when the polyadenylated RNA is isolated from potato. 11. The method according to claim 7, wherein the step of treating the polyadenylated RNA comprises treating the polyadenylated RNA with reverse transcriptase and a PPO specific primer to form first strand cDNA; treating the cDNA so formed with terminal d Transferase to attach a polyadenosine tail sequence at the 3' end of the cDNA; and amplifying the polyadenylated cDNA so formed using PCR. 12. The method according to claim 11, wherein: a) the PPO specific primer is selected from the group consisting of: (i) an oligonucleotide primer having the sequence set forth in SEQ ID NO: 22 when the polyadenylated RNA is isolated from grapevine; and (ii) an oligonucleotide primer having the sequence set forth in SEQ ID NO: 23 when the polyadenylated RNA is isolated from potato; and b) the step of amplifying the cDNA is performed with an oligonucleotide adapter primer having the sequence set forth in SEQ ID NO: 15 and a PPO specific oligonucleotide primer having a sequence selected from the group consisting of: the sequence set forth in SEQ ID NO: 24 when the polyadenylated RNA is isolated from grapevine; and the sequence set forth in SEQ ID NO: 25 when the polyadenylated RNA is isolated from potato. 13. The method according to claim 5, wherein the plasmid expression vector is the plasmid vector Bluescript SK.sup.- and the DNA sequence is a cDNA sequence. 14. The method according to claim 13, wherein the step of deploying the DNA sequence within the plasmid expression vector comprises blunt-ending the cDNA; fractionating the blunt-ended cDNA so formed; isolating a fragment of the expected size; and ligating said fragment into a suitable restriction enzyme site of the Bluescript SK.sup.- vector. 15. A recombinant DNA plasmid comprising: a) DNA comprising nucleotides having a sequence coding for a polypeptide having polyphenol oxidase (PPO) activity, wherein said sequence corresponds to a nucleotide sequence of DNA from a plant selected from the group consisting of grapevine, apple, and broad bean, a nucleotide sequence of DNA from potato selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13; or a nucleotide sequence encoding an amino acid sequence selected from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14; and b) a promoter element upstream of the DNA, wherein said plasmid is capable of being replicated, transcribed and translated in a unicellular organism. 16. A method of increasing the level of PPO activity in a plant comprising providing (i) a DNA construct comprising nucleotides having a sequence coding for a polypeptide having polyphenol oxidase (PPO) activity, wherein said sequence corresponds to a nucleotide sequence of DNA from a plant selected from the group consisting of grapevine, apple, and broad bean, a nucleotide sequence of DNA from potato selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13; or a nucleotide sequence encoding an amino acid sequence selected from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14; and (ii) a plant cell; and introducing said DNA construct into said plant cell and regenerating the cell to produce a transgenic plant, thereby increasing the level of PPO activity in the plant. 17. The method according to claim 16, wherein the DNA construct further comprises a DNA sequence comprising a pre-sequence of a plant PPO gene coding for a transit peptide. 18. The method according to claim 16, wherein the plant cell is from a plant selected from the group consisting of potato, grapevine, apple, and broad bean. 19. The method according to claim 16, wherein the DNA construct comprises a binary vector; and a promoter sequence capable of inducing expression of the polypeptide in a tissue of the transgenic plant. 20. A method of isolating a clone comprising DNA encoding a polyphenol oxidase (PPO) polypeptide of a plant, which method comprises providing a cDNA or genomic library comprising cDNA or genomic DNA isolated from a plant selected from the group consisting of grapevine, apple, broad bean and potato; and a DNA probe comprising a nucleotide sequence capable of hybridizing to a polyphenol oxidase (PPO) cDNA fragment or genomic DNA fragment from a plant selected from the group consisting of grapevine, apple, and broad bean, or to a cDNA fragment or genomic DNA fragment of potato comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13; and a nucleotide sequence encoding an amino acid sequence selected from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14; and hybridizing the probe with the cDNA or genomic library, and isolating the hybridized clone. 21. The method according to claim 20, wherein the DNA probe is prepared by a method which comprises amplifying cDNA using the polymerase chain reaction (PCR). 22. A method of preparing isolated DNA comprising a nucleotide sequence coding for a polypeptide having PPO activity, which method comprises (i) providing (a) mRNA isolated from a plant; and (b) two or more oligonucleotide primers which hybridize to a nucleotide sequence encoding said polypeptide, or to a complementary nucleotide sequence thereto; (ii) treating the mRNA with reverse transcriptase and an adapter primer to form first strand cDNA; (iii) amplifying the cDNA so formed using the oligonucleotide primers and the polymerase chain reaction, and (iv) preparing isolated DNA from the amplified cDNA, wherein the isolated DNA comprises nucleotides having a sequence that corresponds to a nucleotide sequence of DNA from a plant selected from the group consisting of grapevine, apple, and broad bean, a nucleotide sequence of DNA from potato selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13; or a nucleotide sequence encoding an amino acid sequence selected from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14. 23. The method according to claim 16, wherein the DNA construct further comprises a nucleotide sequence which encodes a targeting sequence to direct the polypeptide having PPO activity to a cellular compartment. 24. The recombinant plasmid of claim 15 wherein the promoter is a patatin promoter upstream of the DNA sequence. 25. A transgenic plant which has introduced into its genome DNA comprising nucleotides having a sequence coding for a polypeptide having PPO activity, or a complement of said DNA, which transgenic plant did not comprise the DNA prior to transformation, wherein the sequence corresponds to a nucleotide sequence of DNA from a plant selected from the group consisting of grapevine, apple, and broad bean, a nucleotide sequence of DNA from potato selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13; and a nucleotide sequence encoding an amino acid sequence selected from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14. 26. The transgenic plant of claim 25, wherein the plant has an increased level of PPO expression relative to the level prior to introduction of said DNA. 27. The isolated DNA of claim 1, wherein said DNA comprises a nucleotide sequence selected from the group consisting of: a nucleotide sequence selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13; and a nucleotide sequence encoding an amino acid sequence selected from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14. 28. The isolated DNA of claim 1, wherein the plant is a grapevine plant. 29. The isolated DNA of claim 1, wherein the plant is an apple plant. 30. The isolated DNA of claim 1, wherein the plant is a broad bean plant. 31. An isolated nucleic acid comprising a nucleotide sequence selected from the group consisting of: (i) the nucleotide sequence set forth in SEQ ID NO: 1; (ii) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 2; (iii) a nucleotide sequence encoding a fragment of SEQ ID NO: 2, said fragment having PPO activity in grapevine plants; and (iv) a nucleotide sequence complementary to (i) or (ii). 32. An isolated nucleic acid comprising a nucleotide sequence selected from the group consisting of: (i) the nucleotide sequence set forth in SEQ ID NO: 3; (ii) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 4; and (iii) a nucleotide sequence complementary to (i) or (ii). 33. An isolated nucleic acid comprising a nucleotide sequence selected from the group consisting of: (i) the nucleotide sequence set forth in SEQ ID NO: 5 or SEQ ID NO: 7; (ii) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 6 or SEQ ID NO: 8; and (iii) a nucleotide sequence complementary to (i) or (ii). 34. An isolated nucleic acid comprising a nucleotide sequence selected from the group consisting of: (i) a nucleotide sequence selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 13; (ii) a nucleotide sequence encoding an amino acid sequence selected from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14; and (iii) a nucleotide sequence complementary to (i) or (ii). 35. The transgenic plant of claim 25, wherein the plant is potato. 36. A method of increasing the level of PPO production by a plant comprising providing (a) the isolated DNA of claim 1, and (b) a plant cell, introducing the DNA of part (a) into the plant cell of part (b), and regenerating the plant cell to form a transgenic plant, thereby increasing the level of PPO production by the plant. 37. A transformed plant cell which comprises the isolated DNA of claim 1, which transformed plant cell did not comprise the DNA prior to transformation. 38. The transformed plant cell of claim 37, wherein the DNA is stably incorporated into the genome of the transformed plant cell. Text:BACKGROUND OF THE INVENTION The present invention relates to a method of modifying polyphenol ozidase (PPO) activity in fruit and vegetables and to DNA sequences for use therein. Browning of plant tissues often occurs following injury or damage and this generally results in spoilage of fruit and vegetables. Undesirable browning also occurs during processing of plant materials to produce food or other products. Steps are taken during transport, storage, and processing to prevent these browning reactions. Often this involves the use of chemicals such as sulphur dioxide but the use of these substances is likely to be restricted in the future due to concerns about their safety and consumer acceptance. For example, the US Food and Drug Administration banned the use of sulphite for most fresh fruit and vegetables in 1986. The production of fruit and vegetable varieties with an inherently low susceptibility to brown would remove the need for these chemical treatments. Accordingly, it is an object of the present invention to overcome or at least alleviate one or more of the difficulties related to the prior art. It will be understood that browning in plants is predominantly catalysed by the enzyme PPO. PPO is localised in the plastids of plant cells whereas the phenolic substrates of the enzyme are stored in the plant cell vacuole. This compartmentation prevents the browning reaction from occurring unless the plant cells are damaged and the enzyme and its substrates are mixed. If the amount of this enzyme could be decreased the susceptibility of the tissue to brown would be reduced. PPO sequence information may be used to construct synthetic genes which genes may be transformed into plants to decrease expression of the normal PPO gene, thereby decreasing synthesis of the enzyme. It will also be understood that in certain instances the browning reactions in plants are desirable, such as in the production of black tea, cocoa, coffee, black pepper, black olives, etc. In these instances it may be desirable tb increase the level of PPO to produce desired levels of browning or changes in flavour compounds. The role of PPO in normal plant growth and development is not understood at present. There are a number of instances where increased levels of this enzyme are correlated with increased resistance to plant pathogens. It follow that genetic manipulation of plants to increase the level of PPO activity may confer useful resistance against pathogens and pests. The grapevine PPO gene codes for an additional 103 amino acids upstream of the N-terminus of the mature protein. This region has the properties of a chloroplast transit peptide and is most likely responsible for targeting of the protein to be imported into the chloroplast and processed to produce the mature PPO protein. Transformation of plants with this gene may therefore result in correct targeting and maturation of the grapevine PPO in other species and result in accumulation of active grapevine PPO enzyme in the plastids of these tissues. The terms "gene encoding PPO", "gene coding for PPO" or "PPO gene" as used herein should be understood to refer to the PPO gene or a sequence substantially homologous therewith. SUMMARY OF THE INVENTION In a first aspect of the present invention, there is provided a DNA sequence including a gene coding for a polypeptide having plant polyphenol ozidase (PPO) activity or a fragment thereof. The DNA sequence may include a pre-sequence of a plant PPO gene coding for a transit peptide. The DNA sequence may be modified. The DNA sequence may include a sequence coding for antisense mRNA to a plant PPO gene, or a fragment thereof. The DNA sequence may include a catalytic cleavage site. Alternatively the presequence may be replaced by other targeting sequences to direct the polypeptide having plant PPO activity to other cellular compartments. The DNA sequence may include a putative chloroplast transit sequence and a mature grape vine PPO protein, as illustrated in FIG. 1. The DNA sequence may include a gene coding for a polypeptide having a broad bean leaf PPO activity, as illustrated in FIG. 2. The DNA sequence may include a gene coding for a polypeptide having apple fruit PPO activity, as illustrated in FIG. 3. The DNA sequence may include a gene coding for a polypeptide having potato tuber PPO activity, as illustrated in FIG. 4. In a further aspect of the present invention there is provided a DNA sequence including a sequence coding for antisense mRNA to a plant PPO gene, or a fragment thereof. In a further aspect of the present invention there is provided a method for preparing a recombinant DNA plasmid including a DNA sequence coding for a polypeptide having plant PPO activity or a fragment thereof, which method includes providing a DNA sequence including a gene coding for a polypeptide having PPO activity or a fragment thereof; and a plasmid expression vector; and reacting the DNA sequence and the plasmid expression vector to deploy the DNA sequence within the plasmid expression vector. The DNA sequence coding for PPO may be formed from polyadenylated RNA, for example isolated from a plant sample. The plant may be selected from apples, potatoes, grapes and beans. Preferably the plant sample is isolated from sultana grape berries, broad bean leaves, apple peel or cortex or potato tubers. In order to provide a DNA sequence coding for PPO, in a preferred aspect of the present invention the method for the preparation of a recombinant DNA plasmid may include the preliminary steps of providing a source of a polypeptide having plant PPO activity; isolating polyadenylated RNA coding for a polypeptide having plant PPO activity therefrom; and treating the polyadenylated RNA to construct copy DNA (cDNA). The isolation of the polyadenylated RNA may be conducted utilising an oligo-dT spun column. The step of treating the polyadenylated RNA to construct cDNA according to this aspect of the present invention may include treating the polyadenylated RNA with reverse transcriptase and an adapter primer to form first strand cDNA; and amplifying the cDNA so formed using the polymerase chain reaction (PCR). The step of reacting the polyadenylated RNA with reverse transcriptase may utilise an oligonucleotide adapter primer having the sequence 5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT. (SEQ ID NO:15) The step of amplifying the cDRA may utilise an adapter primer having the sequence 5'-GACTCGAGTCGACATCG (SEQ ID NO:16) and a 5'-end primer. The 5'-end primer may have the sequence 5'-CCIATICAGGCICCIGATATIICIAAGTGTGG (SEQ ID NO:17) when utilized for the amplification of grape cDNA. The 5'-end primer may have the sequence (5'-GCGGATCCTT[CT]TA[CT]GA[CT]GA[GA]AA[CT]AA. (SEQ ID NO:18) when utilized for the amplification of bean cDNA. The 5'-end primer may have the sequence (5'-GCGAATTCGA[AG]GA[TC]ATGGGIAA[TC]TT[TC]TA) (SEQ ID NO:19) when utilised for the amplification of apple cDNA. The 5'-end primer may have the sequences GEN3: (5'-GCGAATTCTT[TC][TC]TICCITT[TC]CA[TC][AC]G) (SEQ ID NO:20) GEN7: (5'-GCGAATTCAA[TC]GTIGA[TC][AC]GIATGTGG) (SEQ ID NO:21) when utilised for the amplification of potato cDNA. Alternatively, the step of treating the polyadenylated RNA to construct cDNA according to this aspect of the present invention may include treating the polyadenylated RNA with reverse transcriptase and a PPO specific primer to form first strand cDNA; treating the cDNA so formed with terminal d Transferase to attach a polyadenosine tail sequence at the 3' end of the cDNA; and amplifying the polyadenylated cDNA so formed by PCR. The step of treating the polyadenylated RNA with reverse transcriptase may utilise a PPO specific oligonucleotide primer having the sequence 5'-AATCTTTGTGGTGACTGGCG (SEQ ID NO:22) for grape PPO or the PPO-specific primer is an oligonucleotide primer having the sequence 5'GACGGTACATTAGTCTTAAAT (SEQ ID NO:23) for potato tuber PPO. The step of amplifying the cDNA may utilise an oligonucleotide adapter primer having the sequence 5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT (SEQ ID NO:15) and a PPO specific oligonucleotide primer having the sequence 5'-ACCATCAGGCACGGTGGCGG (SEQ ID NO:24) for grape PPO or the sequence 5'-TGCTCATCAACTGGAGTTGAG (SEQ ID NO:25) for potato tuber PPO. The plasmid expression vector for the cloning of th double stranded cDNA may be of any suitable type. The plasmid vector Bluescript SK.sup.+ has been found to be suitable. The cloning step may take any suitable form. A preferred form may include blunt-ending the cDNA, for example with Klenow fragment; fractionating the cDNA so formed, for example on an Agarose gel; isolating a fragment of the expected size, for example from the gel; and ligating said fragment into a suitable restriction enzyme site, for example the HindIII or EcoRI site of a Bluescript SK.sup.+ vector. In order to test the clones so formed, a suitable microorganism may be transformed with the plasmid expression vector, the microorganism cultured and the polypeptide encoded therein expressed. The microorganism Escherichia coli DH5 has been found to be suitable. In a further aspect of the present invention there is provided a recombinant DNA plasmid including a DNA sequence coding for a polypeptide having plant PPO activity, or a fragment thereof, which plasmid is capable of being replicated, transcribed and translated in a unicellular organism. The plasmid expression vector may be of any suitable type. The recombinant plasmid may contain a constitutive promoter element upstream of the DNA sequence coding for a polypeptide having PPO activity. In a further aspect of the present invention there is provided a method of decreasing the level of PPO activity in a plant tissue, which method includes providing a DNA construct including a modified gene coding for a polypeptide having plant PPO activity or fragment thereof; and a plant sample; and introducing said DNA construct into said plant sample to produce a transgenic plant. The DNA construct may include a sequence encoding antisense MRNA to a plant PPO gene or a fragment thereof. The DNA construct may include a gene coding for a polypeptide having plant PPO activity or fragment thereof incorporating a catalytic cleavage site. The plant may be of any suitable type. In a preferred aspect the plant may be selected from the group including grapevine, potato, apple and bean. In a further aspect of the present invention there is provided a method of increasing the level of PPO activity in a plant tissue, which method includes providing a DNA construct including a gene coding for a polypeptide having plant PPO activity or a fragment thereof; and a plant sample; and introducing said DNA construct into said plant sample to produce a transgenic plant. The DNA construct may include a DNA sequence encoding a pre-sequence of a plant PPO gene or a fragment thereof. The plant may be of any suitable type. In a preferred aspect the plant may be selected from the group comprising tobacco, broad bean, tomato, tea, coffee and cocoa. The pre-sequence coding for the transit peptide may be replaced with other targeting sequences to direct the PPO protein to other cellular compartments. Sequences are already known which direct foreign genes into the vacuole, mitochondrion or intercellular space of plant cells. In addition the transit sequence for grapevine PPo could be used to target other proteins into the plastids. The DNA construct may include a constitutive promoter which would result in expression of the introduced genes throughout the plant. It will be understood that in many plant tissues PPO is highly expressed in certain tissue types. For example, PPO activity is much higher in the skin of grape berries than in the pulp, and the peel of potato tubers has higher activity than the cortex. It may be desirable to alter levels of PPO activity only in certain plant tissues or at certain stages of plant development and this may be achieved by the use of specific promoter elements. For example, use of the patatin promoter alters PPO levels only in the tuber tissue of potato plants. This decreases PPO activity in the tuber, and reduce browning, but PPO activity in other parts of the potato plant is not altered. Accordingly, the DNA construct may include a promoter which is specific to the peel or skin of fruit and vegetables to target foreign proteins specifically to the outer tissue layers. This may allow properties of the skin or peel, such as colour, flavour, resistance to pathogens, etc to be manipulated independently of the inner parts of the fruit or vegetable which are consumed. In a preferred aspect, the DNA construct may include a binary vector into which has been introduced a DNA sequence encoding PPO or a fragment thereof. In a further preferred aspect, the introduction of the DNA construct into the plant may be by infection of the plant with an Agrobacterium containing the DNA construct. In a further aspect of the present invention there is provided a transgenic plant, which plant contains a synthetic gene capable of modifying expression of the normal PPO gene. The plant may be of any suitable type. In a preferred aspect the plant may be selected from the group comprising grapevine, potato, apple, tobacco, bean, peach, pear and apricot. In a still further aspect of the present invention there is provided a plant vaccine including a sequence encoding PPO or a fragment thereof. In a still further aspect of the present invention there is provided a DNA probe including a DNA sequence coding for a polypeptide having plant PPO activity or a fragment thereof. The probe may be labelled in any suitable manner. A radioactive or non-radioactive labelling may be used. For convenience, the probe may be provided in the form of a cloned insert in a suitable plasmid vector. The grapevine PPO sequence may be used to design general purpose oligonucleotide primers for use in the PCR to obtain this gene from other species. Plant PPO proteins are known to contain copper as a prosthetic group and two regions of the grape protein sequence which show homology to sequences from hemocyanin and tyrosinase proteins, corresponding to the copper binding sites on these proteins have been identified. Since these regions are apparently conserved between widely diverse organisms they are suitable for design of probes and primers to obtain other plant PPO genes. Accordingly, in a still further aspect of the present invention there is provided a method of isolating a DNA sequence including a gene coding for a polypeptide having PPO activity or a fragment thereof from a plant species, which method includes providing a cDNA or genomic library; and a DNA probe including a DNA sequence coding for a polypeptide having plant PPO activity or a fragment thereof; and hybridising the probe with the genomic library to identify clones containing said DNA sequence. The DNA probe may include a DNA sequence including a fragment of the apple, potato, grape or bean PPO gene which is highly conserved between different species. The DNA probe may be prepared by a method which includes providing total cDNA from a plant species; and two or more oligonucleotide primers which hybridise specifically with a gene coding for a polypeptide having plant PPO activity and which include sequences of the apple, potato, grape or bean PPO gene which are highly conserved between different species; and performing PCT to amplify a DNA sequence including a gene coding for a polypeptide having plant PPO activity or a fragment thereof. The oligonucleotide primers may include DNA sequences corresponding to the copper binding sites on the polypeptide having plant PPO activity. In a still further aspect of the present invention there is provided a method of isolating a DNA sequence including a gene coding for a polypeptide having PPO activity, or a fragment thereof, from a plant species, which method includes providing MRNA isolated from the plant; a poly-dT adapter primer; and two or more oligonucleotide primers; treating the mRNA with reverse transcriptase and an adapter primer to form first strand cDNA; and amplifyig the cDNA so formed using the oligonucleotide primers and the polymerase chain reaction. In a preferred aspect the oligonucleotide primers may be based on the apple, potato, grape or bean PPO gene sequences. In a still further aspect of the present invention there is provided a method of isolating a DNA sequence including a gene coding for a polypeptide having PPO activity or a fragment thereof from a plant species, which method includes providing an expression library; and a polyclonal antibody which has been raised against a purified polypeptide having PPO activity; and reacting the polyclonal antibody with the expression library to identify clones containing a DNA sequence including a gene coding for a polypeptide having PPO activity or fragments thereof. In a still further aspect of the present invention there is provided a method for purification of the PPO protein, which method includes providing a plant sample; a detergent; and one or more chromatography columns; extracting the plant sample with the detergent; treating the extract so formed with ammonium sulphate; and fractionating the extract so formed by passing it through the chromatography columns. The plant sample may be of any suitable type. The plant sample may be grapevine berries. This tissue contains high levels of PPO and in the juice of mature grape berries most of the PPO activity is bound to the solids and can be separated from the juice by centrifugation and then solubilised with detergents. The plant sample may be bean leaves. The detergent may be cationic. The detergent hexadecyltrimethylammonium bromide (CTAB) has been found to be suitable. The chromatography columns may be sepharose based. Three chromatography columns may be used. Q-sepharose followed by phenyl-sepharose followed by hydroxylapatite has been found to be suitable. In a further aspect of the present invention there substantially pure form, having the N-terminal amino acid sequence APIQAPDISKCGTATVPDGVTP. (SEQ ID NO:26) The present invention will now be more fully described with reference to the accompanying Examples and drawings. It should be understood, however, that the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above. BRIEF DESCRIPTION OF THE DRAWINGS In the figures: FIGS. 1-1 to 1-4: The composite full-length GP01 cDNA nucleotide sequence and derived protein sequence encoding both the putative chloroplast transit sequence and he mature grapevine PPO protein. The translation start site is shown in bold face and the N-terminal of the mature PPO protein is marked with an asterisk. The dashed line indicates the location of the N-terminal primer and the two solid lines indicate the regions used to construct the two antisense primers for cloning the transit peptide sequence. FIGS. 2-1 and 2-2: Nucleic acid and derived protein sequence of the BPO1 clone of broad bean leaf polyphenol oxidase. The solid line indicates the region of the B15 primer used to amplify the cDNA by the polymerase chain reaction. FIG. 3: Nucleic acid and derived protein sequences of the clones pSR7 (SEQ ID NO:5 and 6, respectively) and pSR8 (SEQ ID NO:7 and 8 respectively) encoding apple fruit PPO. The solid line indicates the region of the GEN4 primer used to amplify the cDNA by the polymerase chain reaction. FIGS. 4-1 to 4-8: Nucleic acid and derived protein sequences of the clones encoding potato tuber PPO. The solid line indicates the region of the GEN3 primer used to amplify the cDNA by the polymerase chain reaction. DETAILED DESCRIPTION OF THE INVENTION EXAMPLE 1 Purification of the PPO Protein PPO was purified from grapevine berries. Initial experiments showed that this tissue contained high levels of the enzyme and that there appeared to be only one form of the enzyme as determined by electrophoresis in sodium dodecyl sulphate polyacrylamide (SDS-PAGE) gels. In the juice of mature grape berries most of the PPO activity was bound to the solids and could be separated from the juice by centrifugation and then solubilised with detergents. Enzyme activity during the purification was measured as oxygen uptake in the presence of the substrate 4-methyl catechol. All steps during the purification were carried out at 4.degree. C. Thirty kilograms of Sultana grapes were crushed with a small scale wine press and 100 ml of a solution of 100 mM ascorbate plus 10 mM dithiothreitol was added to each 900 ml of grape juice. The juice was centrifuged for 10 mins at 10,000.times.g and the supernatant discarded. The pellet fraction was resuspended in 25 mM sodium phosphate, pH 7.2 plus 10 mM ascorbate and 1 mM dithiothreitol to a final volume of 1.75 L, then 250 ml of a 4% (w/v) solution of the cationic detergent hezadecyltrimethylammonium bromide (CTAB) was added. After incubating for 20 mins the extract was centrifuged for 15 mins at 15,000.times.g. The supernatant was brought to 45% saturation with solid ammonium sulphate and the pH was adjusted to 7.0 then it was centrifuged for 15 mins at 15,000.times.g. This supernatant was brought to 95% saturation with solid ammonium sulphate and the pH was adjusted to 7.0 then it was centrifuged for 30 mins at 15,000.times.g. The pellet was resuspended in 20 mM Bis-tris-propane, pH 7.5 plus 10 mM ascorbate and 2 mM dithiothreitol (Buffer A) in a final volume of 100 ml. The extract was desalted on a 4.times.40 cm column of Sephadex G25 equilibrated with Buffer A at a flow rate of 10 ml/min and the active fractions were pooled. The extract was applied to a 2.5.times.10 cm column of Q-Sepharose Fast Flow equilibrated with Buffer A at a flow rate of 6 ml/min and then the column was washed with 400 ml of Buffer A. The PPO was eluted with a gradient of 0-500 mM NaCl in Buffer A and the active fractions were pooled. Ammonium sulphate was added to a final concentration of 1M, and the pH was adjusted to 7.0. This fraction was loaded onto a 1.times.35 cm column of Phenyl Sepharose Fast Flow equilibrated with 50 mM sodium phosphate, pH7.0, plus 1M ammonium sulphate, 1M KCl, and 1 mM dithiothreitol (Buffer B) at a flow rate of 1.5 ml/min. The column was washed with 120 ml Buffer B then the PPO was eluted with a gradient of 100-0% Buffer B. The active fractions were pooled and concentrated on an Amicon PM10 ultrafiltration membrane then diafiltered with the same membrane against three changes of 20 mM potassium phosphate, pH7.0, plus 1 mM dithiothreitol (Buffer C). This fraction was applied to a 1.times.30 cm column of Hydroxylapatite equilibrated with Buffer C at a flow rate of 1 ml/min. The column was washed with 50 ml of Buffer C then PPO was eluted with a gradient of 0-500 mM potassium phosphate in Buffer C. The pooled active fractions were made 20% (v/v) in glycerol and frozen at -80.degree. C. This procedure resulted in a 180-fold purification of PPO and yielded 3.5 mg of purified PPO protein. The purification is summarised below: PURIFICATION OF GRAPE BERRY PPO Spec. Protein Act. Act. Recov. Purif. Step (mg) (U) (U/mg) (%) (-fold) Juice* 19,360 7,040 0.4 100 1 CTAB extract 960 2,070 2.2 29 6 Ammonium sulphate 600 1,760 2.9 25 8 Q-Sepharose 130 1,520 11.8 22 33 Phenyl Sepharose 10.8 400 37 6 103 Hydroxylapatite 3.5 230 65 3 180 *From 30 Kg grapes The purity of the preparation was checked by denaturing SDS-PAGE. A single diffuse band of protein with an apparent molecular weight of 40 kDa was present in the final preparation. EXAMPLE 2 Amino Acid Sequencing Approximately 1 mg of purified PPO protein was desalted on a 2.5.times.20 cm column of Sephadex G25 equilibrated with 20 mM ammonium bicarbonate, pH7.6, at a flow rate of 5 ml/min. The protein peak was collected and dried under nitrogen. The dried protein was carboxymethylated and the N-terminal amino acid sequence was determined with an automated amino acid sequenator by Edman degradation. The following sequence was obtained: APIQAPDISKCGTATVPDGVTP (SEQ ID NO:26) EXAMPLE 3 Cloning of Grape PPO Gene Total RNA was isolated from sultana grape berries according to the method of Rezaian and Krake (1). A poly(A).sup.+ -enriched RNA fraction was obtained by passing the total RNA through one oligo-dT spun column (Pharmacia LKB Biotechnology). First strand cDNA was synthesised in a reaction mixture containing 50 mM Tris-HCl pH 8.3, 25 mM KCl, 10 mM MgCl.sub.2, 4 mM DTT, 1 mM NaPPi, 1 mM dNTPs, 1 U ribonuclease inhibitor, 1.4 pg grape berry poly(A).sup.+ -enriched RNA, 21 U AMV reverse transcriptase (Promega Corp) and 0.5 .mu.g Hybrid dT17-adapter primer (5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT(SEQ ID NO:15) at 42.degree. C. for 1 h. The reaction mixture was then diluted to 800 .mu.l with TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA) and stored at -20.degree. C. A 32-mer oligonucleotide primer (5'-CCIATICAGGCICCIGATATIICIAAGTGTGG) (SEQ ID NO:17) was designed to the N-terminal protein sequence (amino acids 2-12) of purified grape PPO. Inosine was utilised in positions in which more than 2 bases could be selected based on codon usage tables. This and all other oligonucleotide primers described were synthesised on an Applied Biosystems DNA synthesiser. cDNA was amplified by polymerase chain reaction (PCR) essentially according to the method of Frohman (2) in a 50 .mu.l reaction mixture containing 10 mM Tris-HCl (pH 9.0 at 25.degree. C.), 50 mM KCl, 1.5 mM MgCl.sub.2, 0.2 mM dNTPs, 0.01% gelatin (w/v), 0.1% Triton X-100, 5 .mu.l diluted 1st. strand cDNA reaction mixture, 1.25 U Taq DNA polymerase (Promega Corp), 100 nM Adapter primer (5'-GACTCGAGTCGACATCG) (SEQ ID NO:16) and 1 .mu.M N-terminal primer (described above). Amplification involved an initial program of 5 cycles of denaturation at 94.degree. C. for 1 min, annealing at 55.degree. C. for 1 min, a slow ramp to 72.degree. C. over 2 min and elongation at 72.degree. C. for 3 min followed by 25 cycles of 94.degree. C. for 1 min, 55.degree. C. for 1 min, and 72.degree. C. for 3 min. Amplified DNA was extracted with phenol/chloroform, precipitated with ethanol and resuspended in TE. DNA was blunt-ended with the Klenow fragment and fractionated on a 2% Nusieve GTG agarose (FMC Bioproducts) gel. A 1700 bp fragment was isolated from the gel and ligated into the HincII site of a Bluescript SK.sup.+ vector (stratagene Cloning Systems). Ligated DNA was introduced into E. coli DH5. Positive clones (designated GPO) were isolated and sequenced by the dideoxy sequencing method (3). This confirmed the presence of the N-terminal primer and comparison of the derived protein sequence downstream of the primer with the N-terminal protein sequence obtained for purified grape PPO enzyme above confirmed that this clone coded for grape PPO. EXAMPLE 4 Cloning the Transit Peptide Sequence Northern blots of grape mRNA probed with the 1700 bp clone described above identified a transcript of 2200 bp which hybridised with the clone. This suggested that there was further sequence upstream of the 5-prime end of the clone even though the clone did code for the N-terminal of the mature PPO protein. A cDNA clone containing the 5'-end of GPO1 MRNA (encoding the putative transit peptide) was amplified from grape berry RNA essentially as described in (2), but with nested antisense primers. First strand cDNA was synthesised from grape berry poly(A).sup.+ -enriched RNA as described above, but with the Hybrid dT17-adapter primer replaced with GPO1-specific primer 1 (5'-AATCTTTGTGGTGACTGGCG) (SEQ ID NO:22) complementary to a region 44 bases downstream of the N-terminal primer region (i.e. 416-435 nt; FIG. 1). The reaction mixture was diluted to 2 ml with 0.1.times. TE and centrifuged through a Centricon 30 spin filter (Amicon Corp) at 4000 g for 20 win to remove excess primer. This step was repeated and the remaining liquid concentrated to 20 .mu.l using Speed Vac centrifugation. A poly (dA)-tail sequence was attached at the 3'end of the cDNA strand with Terminal d Transferase (Promega Corp) in a 20 .mu.l reaction mixture containing 11.5 .mu.l cDNA, 4 .mu.l 5.times. Tailing Buffer (Promega Corp), 4 .mu.l ATP (1 MM) and 10 U Terminal d Transferase incubated at 37.degree. C. for 5 win followed by 65.degree. C. for 5 min and then diluted to 500 .mu.l with TE. PCR amplification of poly(dA)-tailed cDNA was carried out in a reaction mixture containing 10 mM Tris-HCl (pH 9.0 at 25.degree. C.), 50 mM KCl, 1.5 mM MgCl.sub.2, 0.2 mM dNTPs, 0.01% gelatin (w/v), 0.1% Triton X-100, 5 .mu.l diluted 1st. strand cDNA reaction mixture, 1.25 U Taq DNA polymerase (Promega Corp), 200 rnM Hybrid dT17-adapter primer and 900 nM GPO1-specific primer 2 (5'-ACCATCAGGCACGGTGGCGG) (SEQ ID NO:24) complementary to a region immediately downstream to the N-terminal primer binding region (374-393 nt; FIG. 1). Amplification involved 25 cycles of 94.degree. C. for 1 min, 55.degree. C. for 1 min, and 72.degree. C. for 3 min. The resulting 430 bp fragment was cloned into Bluescript SK.sup.+ vector, sequenced as described above and found to contain the predicted region of overlapping sequence with the GPO1 clone and confirming this cDNA clone contained the 5' end of the GPO1 mRNA. EXAMPLE 5 Cloning of the Bean Leaf PPO Gene Total RNA was isolated from leaves of broad bean according to the method of Rezaian and Krake (1). A poly(A)+-enriched RNA fraction was obtained by passing the total RNA through one oligo-dT spun column (Pharmacia LKB Biotechnology). First strand cDNA was synthesised in a reaction mixture containing 50 mM Tris-HCl pH 8.3, 25 mM KCl, 10 mM MgCl.sub.2, 4 mM DTT, 1 mM NaPPi, 1 mM dNTPs, 1 U ribonuclease inhibitor, 3.1 .mu.g broad bean poly(A).sup.+ -enriched RNA, 21 U AMV reverse transcriptase (Promega Corp) and 0.81 .mu.g Hybrid dT17-adapter primer: (5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT) (SEQ ID NO:15) at 42.degree. C. for 1 hour. The reaction mixture was then diluted to 840 .mu.l with TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA) and stored at -20.degree. C. A 25-mer oligonucleotide primer (B15): (5'-GCGGATCCTT[CT]TA[CT]GA[CT]GA[GA]AA[CT]AA) (SEQ ID NO:18) was designed based on the sequence of grape PPO. cDNA was amplified by polymerase chain reaction (PCR) essentially according to the method of Frohman (2) in a 100 .mu.l reaction mixture containing 10 mM Tris-HCl (pH 9.0 at 25.degree. C.), 50 mM KCl, 1.5 mM MgCl.sub.2, 0.2 mM dNTPs, 0.01% gelatin (w/v), 0.1% Triton X-100, 20 .mu.l diluted 1st. strand cDNA reaction mixture, 2.5 U Tag DNA polymerase (Promega Corp), 100 nM Adapter primer (5'-GACTCGAGTCGACATCG) (SEQ ID NO:16) and 1 .mu.M B15 primer (described above). Amplification involved an initial program of 3 cycles of denaturation at 94.degree. C. for 1 min, annealing at 37.degree. C. for 2 min, a slow ramp to 72.degree. C. over 2 min and elongation at 72.degree. C. for 3 min followed by 25 cycles of 94.degree. C. for 1 min, 55.degree. C. for 1 min. and 72.degree. C. for 3 min. Amplified DNA was extracted with phenol/chloroform, precipitated with ethanol and resuspended in TE. DNA was blunt-ended with the Klenow fragment and fractionated on a 2% Nusieve GTG agarose (FMC Bioproducts) gel. A 700 bp fragment was isolated from the gel and ligated into the EcoRV site of a Bluescript SR.sup.+ vector (Stratagene Cloning Systems). Ligated DNA was introduced into E. coli DH5. Recombinant clones were screened using a radioactively labelled fragment of the grape PPO clone (GPO1) and a positive clone (designated BPO1) was isolated and sequenced by the dideoxy sequencing method (3). EXAMPLE 6 Cloning of Apple PPO Genes Total RNA was isolated from immature apple fruit according to the method of Rezaian and Krake (1). A poly(A).sup.30 -enriched RNA fraction was obtained using a PolyATtract mRNA kit (Promega corporation). First strand cDNA was synthesised in a 25 .mu.l reaction mixture containing 50 mM Tris-HCl pH 8.3, 25 mM KCl, 10 mM MgCl2, 4 mM DTT, 1 mM NaPPi, 1 mM dNTPs, 40 U ribonuclease inhibitor, 1 .mu.g apple poly(A).sup.+ -enriched RNA, 24 U AMV reverse transcriptase (Promega Corp) and 0.54 .mu.g Hybrid dT17-adapter primer: (5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT) (SEQ ID NO:15) at 42.degree. C. for 1 h. The reaction mixture was then diluted to 525 .mu.l with TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA) and stored at -20.degree. C. A 28-mer oligonucleotide primer (GEN4): (5'-GCGAATTCGA[AG]GA[TC]ATGGGIAA[TC]TT[TC]TA) (SEQ ID NO:19) was designed based on the sequence of grape PPO. cDNA was amplified by polymerase chain reaction (PCR) essentially according to the method of Frohman (2) in a 100 .mu.l reaction mixture containing 10 mM Tris-HCl (pH 9.0 at 25.degree. C.), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.01% gelatin (w/v), 0.1% Triton X-100, 20 .mu.l diluted 1st. strand cDNA reaction mixture, 2.5 U Taq DNA polymerase (Promega Corp), 100 nM Adapter primer (5'-GACTCGAGTCGACATCG) (SEQ ID NO:16) and 1 .mu.M GEN4 primer (described above). Amplification involved an initial program of 3 cycles of denaturation at 94.degree. C. for 1 min, annealing at 37.degree. C. for 2 min, a slow ramp to 72.degree. C. over 2 min and elongation at 72.degree. C. for 3 min followed by 25 cycles of 94.degree. C. for 1 min, 55.degree. C. for 1 min, and 72.degree. C. for 3 min. Amplified DNA was extracted with phenol/chloroform, precipitated with ethanol and resuspended in TE. DNA was blunt-ended with the Klenow fragment and fractionated on a 2% Nusieve GTG agarose (FMC Bioproducts) gel. A fragment of 1050 bp was isolated from the gel and ligated into the Eco RV site of a Bluescript SK+ vector (Stratagene Cloning Systems). Ligated DNA was introduced into E. coli DH5. Recombinant clones were screened using a radioactively labelled fragment of the grape PPO clone (GPO1) and two positive clones (designated pSR7 and pSR8) were isolated and sequenced by the dideoxy sequencing method (3). EXAMPLE 7 Cloning of Potato PPO Genes Total RNA was isolated from immature potato tubers according to the method of Logemann et al (4). A poly(A).sup.+ -enriched RNA fraction was obtained using a PolyATtract mRNA kit (Promega corporation). First strand cDNA was synthesised in a 25 .mu.l reaction mixture containing 50 mM Tris-HCl pH 8.3, 25 mM KCl, 10 mM MgCl2, 4 mM DTT, 1 mM NaPPi, 1 mM dNTPs, 40 U ribonuclease inhibitor, 1.8 .mu.g potato poly(A).sup.+ -enriched RNA, 24 U AMV reverse transcriptase (Promega Corp) and 0.54 .mu.g Hybrid dT17-adapter primer: (5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT) (SEQ ID NO:15) at 42.degree. C. for 1 h. The reaction mixture was then diluted to 525 .mu.l with TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA) and stored at -20.degree. C. Two oligonucleotide primers were designed from regions within the sequences of grape and apple PPO: GEN3: (5'-GCGAATTCTT[TC][TC]TICCITT[TC]CA[TC][AC]G) (SEQ ID NO:20) GEN7: (5'-GCGAATTCAA[TC]GTIGA[TC][AC]GIATGTGG) (SEQ ID NO:21) cDNA was amplified by the polymerase chain reaction (PCR) essentially according to the method of Frohman (2) in a 100 .mu.l reaction mixture containing 10 mM Tris-HCl (pH 9.0 at 25.degree. C.), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.01% gelatin (w/v), 0.1% Triton X-100, 20 .mu.l diluted 1st. strand cDNA reaction mixture, 2.5 U Taq DNA polymerase (Promega Corp), 100 nM Adapter primer (5'-GACTCGAGTCGACATCG) (SEQ ID NO:16) and 1 .mu.M GEN primer (described above). Amplification involved an initial program of 3 cycles of denaturation at 94.degree. C. for 1 min, annealing at 37.degree. C. for 2 min, a slow ramp to 72.degree. C. over 2 min and elongation at 72.degree. C. for 3 min followed by 25 cycles of 94.degree. C. for 1 min, 55.degree. C. for 1 min, and 72.degree. C. for 3 min. Amplified DNA was extracted with phenol/chloroform, precipitated with ethanol and resuspended in TE. DNA was blunt-ended with the Klenow fragment and fractionated on a 2% Nusieve GTG agarose (FMC Bioproducts) gel. Fragments of 1500 bp and 1000 bp were isolated from the gel and ligated into the Eco RV site of a Bluescript SK+ vector (Stratagene Cloning Systems). Ligated DNA was introduced into E. coli DH5. Recombinant clones were selected and three clones (designated pSRP32, pSRP33, and pSRP72) were isolated and sequenced by the dideoxy sequencing method (3). cDNA clones containing the 5'-end of potato tuber PPO mRNA were amplified from potato tuber RNA essentially as described in (2), but with nested antisense primers. First strand cDNA was synthesised from potato tuber poly(A).sup.+ -enriched RNA as described above, but with the Hybrid dT17-adapter primer replaced with potato tuber PPO-specific primer 1: (5'-GACGGTACATTAGTGTTAAAT) (SEQ ID NO:27) complementary to a region 257-278 bases downstream of the 5'-end of pSRP32 and pSRP33. The reaction mixture was diluted to 2 ml with 0.1.times. TE and centrifuged through a Centricon 30 spin filter (Amicon Corp) at 4000 g for 20 min to remove excess primer. This step was repeated and the remaining liquid concentrated to 12 .mu.l using Speed Vac centrifugation. A poly (dA)-tail sequence was attached at the 3'end of the cDNA strand with Terminal d Transferase (Promega Corp) in a 20 .mu.l reaction mixture containing 11.5 .mu.l cDNA, 4 .mu.l 5.times. Tailing Buffer (Promega Corp), 4 .mu.l ATP (1 mM) and 10 U Terminal d Transferase incubated at 37.degree. C. for 5 min followed by 65.degree. C. for 5 min and then diluted to 500 .mu.l with TE. PCR amplification of poly(dA)-tailed cDNA was carried out in a reaction mixture containing 10 mM Tris-HCl (pH 9.0 at 25.degree. C.), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.01% gelatin (w/v), 0.1% Triton X-100, 5 .mu.l diluted 1st. strand cDNA reaction mixture, 1.25 U Taq DNA polymerase (Promega Corp), 200 nM Hybrid dT17-adapter primer and 900 nM potato tuber PPO-specific primer 2 (5'-TGCTCATCAACTGGAGTTGAG) (SEQ ID NO:25) complementary to a region 233-254 bases downstream of the 5'-end of pSRP32 and pSRP33. Amplification involved 25 cycles of 94.degree. C. for 1 min, 50.degree. C. for 1 min, and 72.degree. C. for 3 min. The resulting fragment was cloned into Bluescript SK+ vector, sequenced as described above and found to contain the predicted region of overlapping sequence with the pSRP32 clone confirming this cDNA clone contained the 5'-end of the potato tuber mRNA. REFERENCES 1. Rezaian, M. A. and Krake, L. R. (1987). Nucleic acid extraction and vine detection in grapevine. J. Vir. Methods 17: 277-285. 2. Frohman, M. A. (1990) in PCR Protocols: A Guide to Methods and Applications (eds. M. A. Innis, Gelfand, D. H., Sninsky, J. J., White, T. J.) Academic Press, New York pp28-38. 3. Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. 4. Logemann, J., Schell, J. and Willmitzer, L. (1987). Improved method for the isolation of RRA from plant tissues. Analytical Biochemistry 163:16-20. Finally, it is to be understood that various other modifications and/or alterations may be made without departing from the spirit of the present invention as outlined herein. SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 27 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1990 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (vii) IMMEDIATE SOURCE: (B) CLONE: GPO1 cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 28..1848 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1 ATCACTCATC ACTCCTCCTC TAAAGCT ATG GCT TCT TTG CCT TGG TCG CTC 51 Met Ala Ser Leu Pro Trp Ser Leu 1 5 ACA ACC TCC ACC GCC ATC GCC AAC ACC ACC AAC ATT TCA GCC TTC CCA 99 Thr Thr Ser Thr Ala Ile Ala Asn Thr Thr Asn Ile Ser Ala Phe Pro 10 15 20 CCT TCT CCC TTG TTT CAA AGG GCT TCT CAT GTC CCC GTA GCC AGA AAC 147 Pro Ser Pro Leu Phe Gln Arg Ala Ser His Val Pro Val Ala Arg Asn 25 30 35 40 CGA AGC CGC AGA TTT GCT CCT AGT AAG GTG TCG TGC AAT TCT GCG AAT 195 Arg Ser Arg Arg Phe Ala Pro Ser Lys Val Ser Cys Asn Ser Ala Asn 45 50 55 GGT GAT CCC AAC TCG GAT TCT ACC TCC GAC GTT CGA GAA ACT TCC TCA 243 Gly Asp Pro Asn Ser Asp Ser Thr Ser Asp Val Arg Glu Thr Ser Ser 60 65 70 GGG AAG TTA GAT AGG AGG AAT GTG CTT CTT GGC ATA GGA GGG CTG TAT 291 Gly Lys Leu Asp Arg Arg Asn Val Leu Leu Gly Ile Gly Gly Leu Tyr 75 80 85 GGT GCT GCT GGC GGT CTC GGC GCC ACT AAG CCA TTA GCC TTT GGG GCT 339 Gly Ala Ala Gly Gly Leu Gly Ala Thr Lys Pro Leu Ala Phe Gly Ala 90 95 100 CCC ATC CAG GCA CCG GAT ATA TCC AAG TGT GGT ACC GCC ACC GTG CCT 387 Pro Ile Gln Ala Pro Asp Ile Ser Lys Cys Gly Thr Ala Thr Val Pro 105 110 115 120 GAT GGT GTA ACG CCC ACA AAT TGC TGC CCG CCA GTC ACC ACA AAG ATT 435 Asp Gly Val Thr Pro Thr Asn Cys Cys Pro Pro Val Thr Thr Lys Ile 125 130 135 ATA GAT TTC CAG CTA CCT TCC TCA GGT TCC CCC ATG CGT ACC AGG CCA 483 Ile Asp Phe Gln Leu Pro Ser Ser Gly Ser Pro Met Arg Thr Arg Pro 140 145 150 GCT GCT CAC TTG GTC AGC AAA GAG TAC TTA GCC AAG TAT AAA AAG GCC 531 Ala Ala His Leu Val Ser Lys Glu Tyr Leu Ala Lys Tyr Lys Lys Ala 155 160 165 ATT GAG CTG CAG AAA GCT CTT CCT GAT GAT GAT CCG CGT AGT TTC AAG 579 Ile Glu Leu Gln Lys Ala Leu Pro Asp Asp Asp Pro Arg Ser Phe Lys 170 175 180 CAA CAG GCT AAT GTC CAT TGC ACC TAT TGC CAA GGG GCT TAT GAT CAG 627 Gln Gln Ala Asn Val His Cys Thr Tyr Cys Gln Gly Ala Tyr Asp Gln 185 190 195 200 GTT GGG TAT ACC GAC CTA GAA CTC CAG GTT CAT GCT TCA TGG CTT TTC 675 Val Gly Tyr Thr Asp Leu Glu Leu Gln Val His Ala Ser Trp Leu Phe 205 210 215 CTC CCT TTC CAC CGT TAC TAT CTC TAC TTC AAT GAG AGA ATT CTT GCA 723 Leu Pro Phe His Arg Tyr Tyr Leu Tyr Phe Asn Glu Arg Ile Leu Ala 220 225 230 AAG TTG ATC GAC GAT CCC ACC TTC GCT TTG CCC TAT TGG GCT TGG GAT 771 Lys Leu Ile Asp Asp Pro Thr Phe Ala Leu Pro Tyr Trp Ala Trp Asp 235 240 245 AAC CCT GAT GGC ATG TAT ATG CCG ACC ATC TAT GCT AGT TCC CCA TCA 819 Asn Pro Asp Gly Met Tyr Met Pro Thr Ile Tyr Ala Ser Ser Pro Ser 250 255 260 TCA CTC TAC GAC GAG AAG CGC AAC GCC AAG CAC CTG CCT CCG ACT GTG 867 Ser Leu Tyr Asp Glu Lys Arg Asn Ala Lys His Leu Pro Pro Thr Val 265 270 275 280 ATC GAT CTC GAC TAC GAT GGC ACC GAA CCC ACA ATC CCT GAT GAC GAA 915 Ile Asp Leu Asp Tyr Asp Gly Thr Glu Pro Thr Ile Pro Asp Asp Glu 285 290 295 CTA AAA ACC GAC AAT CTG GCA ATC ATG TAC AAA CAA ATT GTG TCG GGT 963 Leu Lys Thr Asp Asn Leu Ala Ile Met Tyr Lys Gln Ile Val Ser Gly 300 305 310 GCC ACG ACT CCT AAG CTT TTC CTT GGT TAC CCA TAC CGC GCC GGC GAT 1011 Ala Thr Thr Pro Lys Leu Phe Leu Gly Tyr Pro Tyr Arg Ala Gly Asp 315 320 325 GCG ATT GAC CCT GGA GCG GGT ACC CTT GAG CAC GCC CCA CAT AAT ATA 1059 Ala Ile Asp Pro Gly Ala Gly Thr Leu Glu His Ala Pro His Asn Ile 330 335 340 GTC CAC AAA TGG ACT GGT CTT GCT GAT AAG CCT AGT GAG GAC ATG GGA 1107 Val His Lys Trp Thr Gly Leu Ala Asp Lys Pro Ser Glu Asp Met Gly 345 350 355 360 AAC TTC TAT ACT GCC GGC AGA GAC CCC ATA TTC TTC GGT CAC CAC GCC 1155 Asn Phe Tyr Thr Ala Gly Arg Asp Pro Ile Phe Phe Gly His His Ala 365 370 375 AAT GTC GAT CGG ATG TGG AAT ATA TGG AAA ACT ATA GGA GGT AAA AAT 1203 Asn Val Asp Arg Met Trp Asn Ile Trp Lys Thr Ile Gly Gly Lys Asn 380 385 390 AGA AAG GAT TTC ACG GAT ACG GAT TGG CTT GAC GCC ACG TTC GTC TTC 1251 Arg Lys Asp Phe Thr Asp Thr Asp Trp Leu Asp Ala Thr Phe Val Phe 395 400 405 TAC GAC GAG AAC AAA CAA CTT GTT AAA GTC AAG GTC TCG GAC TGT GTC 1299 Tyr Asp Glu Asn Lys Gln Leu Val Lys Val Lys Val Ser Asp Cys Val 410 415 420 GAC ACT TCC AAG CTG AGA TAC CAA TAT CAG GAT ATT CCT ATT CCA TGG 1347 Asp Thr Ser Lys Leu Arg Tyr Gln Tyr Gln Asp Ile Pro Ile Pro Trp 425 430 435 440 CTA CCA AAA AAT ACG AAG GCC AAA GCG AAG ACG ACC ACC AAA AGT TCC 1395 Leu Pro Lys Asn Thr Lys Ala Lys Ala Lys Thr Thr Thr Lys Ser Ser 445 450 455 AAG TCG GGA GTA GCG AAA GCG GCC GAA CTC CCA AAG ACG ACG ATC AGC 1443 Lys Ser Gly Val Ala Lys Ala Ala Glu Leu Pro Lys Thr Thr Ile Ser 460 465 470 AGC ATC GGA GAC TTC CCA AAA GCT CTT AAC TCA GTG ATA AGA GTA GAA 1491 Ser Ile Gly Asp Phe Pro Lys Ala Leu Asn Ser Val Ile Arg Val Glu 475 480 485 GTT CCA AGG CCA AAG AAA TCA AGA AGC AAG AAG GAG AAA GAG GAT GAG 1539 Val Pro Arg Pro Lys Lys Ser Arg Ser Lys Lys Glu Lys Glu Asp Glu 490 495 500 GAA GAG GTG TTA CTG ATA AAA GGA ATA GAG CTA GAT AGA GAG AAT TTC 1587 Glu Glu Val Leu Leu Ile Lys Gly Ile Glu Leu Asp Arg Glu Asn Phe 505 510 515 520 GTG AAG TTT GAT GTG TAC ATC AAC GAC GAA GAT TAT TCA GTG AGT AGG 1635 Val Lys Phe Asp Val Tyr Ile Asn Asp Glu Asp Tyr Ser Val Ser Arg 525 530 535 CCT AAG AAT AGT GAG TTT GCA GGA AGC TTT GTG AAC GTA CCA CAC AAG 1683 Pro Lys Asn Ser Glu Phe Ala Gly Ser Phe Val Asn Val Pro His Lys 540 545 550 CAT ATG AAA GAA ATG AAG ACG AAG ACC AAT CTG AGG TTC GCG ATA AAT 1731 His Met Lys Glu Met Lys Thr Lys Thr Asn Leu Arg Phe Ala Ile Asn 555 560 565 GAG CTG TTA GAG GAC TTG GGA GCC GAA GAT GAT GAG AGT GTG ATC GTG 1779 Glu Leu Leu Glu Asp Leu Gly Ala Glu Asp Asp Glu Ser Val Ile Val 570 575 580 ACT ATA GTC CCT CGT GCT GGG GGC GAT GAT GTC ACC ATT GGT GGA ATT 1827 Thr Ile Val Pro Arg Ala Gly Gly Asp Asp Val Thr Ile Gly Gly Ile 585 590 595 600 GAG ATC GAG TTT GTT TCC GAT TGATCCCATC TTTCAATGAT TATCCATTAT 1878 Glu Ile Glu Phe Val Ser Asp 605 ATGTATGTAT CAGGTAAGTC ACATCTTTAT GTGATTAATG GAAAATGTGA GACTTCTCTG 1938 TACTTTCCCG TCAAGTCTTT TATTAATTTA GAGCGTTGGT TAAAAAAAAA AA 1990 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 607 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2 Met Ala Ser Leu Pro Trp Ser Leu Thr Thr Ser Thr Ala Ile Ala Asn 1 5 10 15 Thr Thr Asn Ile Ser Ala Phe Pro Pro Ser Pro Leu Phe Gln Arg Ala 20 25 30 Ser His Val Pro Val Ala Arg Asn Arg Ser Arg Arg Phe Ala Pro Ser 35 40 45 Lys Val Ser Cys Asn Ser Ala Asn Gly Asp Pro Asn Ser Asp Ser Thr 50 55 60 Ser Asp Val Arg Glu Thr Ser Ser Gly Lys Leu Asp Arg Arg Asn Val 65 70 75 80 Leu Leu Gly Ile Gly Gly Leu Tyr Gly Ala Ala Gly Gly Leu Gly Ala 85 90 95 Thr Lys Pro Leu Ala Phe Gly Ala Pro Ile Gln Ala Pro Asp Ile Ser 100 105 110 Lys Cys Gly Thr Ala Thr Val Pro Asp Gly Val Thr Pro Thr Asn Cys 115 120 125 Cys Pro Pro Val Thr Thr Lys Ile Ile Asp Phe Gln Leu Pro Ser Ser 130 135 140 Gly Ser Pro Met Arg Thr Arg Pro Ala Ala His Leu Val Ser Lys Glu 145 150 155 160 Tyr Leu Ala Lys Tyr Lys Lys Ala Ile Glu Leu Gln Lys Ala Leu Pro 165 170 175 Asp Asp Asp Pro Arg Ser Phe Lys Gln Gln Ala Asn Val His Cys Thr 180 185 190 Tyr Cys Gln Gly Ala Tyr Asp Gln Val Gly Tyr Thr Asp Leu Glu Leu 195 200 205 Gln Val His Ala Ser Trp Leu Phe Leu Pro Phe His Arg Tyr Tyr Leu 210 215 220 Tyr Phe Asn Glu Arg Ile Leu Ala Lys Leu Ile Asp Asp Pro Thr Phe 225 230 235 240 Ala Leu Pro Tyr Trp Ala Trp Asp Asn Pro Asp Gly Met Tyr Met Pro 245 250 255 Thr Ile Tyr Ala Ser Ser Pro Ser Ser Leu Tyr Asp Glu Lys Arg Asn 260 265 270 Ala Lys His Leu Pro Pro Thr Val Ile Asp Leu Asp Tyr Asp Gly Thr 275 280 285 Glu Pro Thr Ile Pro Asp Asp Glu Leu Lys Thr Asp Asn Leu Ala Ile 290 295 300 Met Tyr Lys Gln Ile Val Ser Gly Ala Thr Thr Pro Lys Leu Phe Leu 305 310 315 320 Gly Tyr Pro Tyr Arg Ala Gly Asp Ala Ile Asp Pro Gly Ala Gly Thr 325 330 335 Leu Glu His Ala Pro His Asn Ile Val His Lys Trp Thr Gly Leu Ala 340 345 350 Asp Lys Pro Ser Glu Asp Met Gly Asn Phe Tyr Thr Ala Gly Arg Asp 355 360 365 Pro Ile Phe Phe Gly His His Ala Asn Val Asp Arg Met Trp Asn Ile 370 375 380 Trp Lys Thr Ile Gly Gly Lys Asn Arg Lys Asp Phe Thr Asp Thr Asp 385 390 395 400 Trp Leu Asp Ala Thr Phe Val Phe Tyr Asp Glu Asn Lys Gln Leu Val 405 410 415 Lys Val Lys Val Ser Asp Cys Val Asp Thr Ser Lys Leu Arg Tyr Gln 420 425 430 Tyr Gln Asp Ile Pro Ile Pro Trp Leu Pro Lys Asn Thr Lys Ala Lys 435 440 445 Ala Lys Thr Thr Thr Lys Ser Ser Lys Ser Gly Val Ala Lys Ala Ala 450 455 460 Glu Leu Pro Lys Thr Thr Ile Ser Ser Ile Gly Asp Phe Pro Lys Ala 465 470 475 480 Leu Asn Ser Val Ile Arg Val Glu Val Pro Arg Pro Lys Lys Ser Arg 485 490 495 Ser Lys Lys Glu Lys Glu Asp Glu Glu Glu Val Leu Leu Ile Lys Gly 500 505 510 Ile Glu Leu Asp Arg Glu Asn Phe Val Lys Phe Asp Val Tyr Ile Asn 515 520 525 Asp Glu Asp Tyr Ser Val Ser Arg Pro Lys Asn Ser Glu Phe Ala Gly 530 535 540 Ser Phe Val Asn Val Pro His Lys His Met Lys Glu Met Lys Thr Lys 545 550 555 560 Thr Asn Leu Arg Phe Ala Ile Asn Glu Leu Leu Glu Asp Leu Gly Ala 565 570 575 Glu Asp Asp Glu Ser Val Ile Val Thr Ile Val Pro Arg Ala Gly Gly 580 585 590 Asp Asp Val Thr Ile Gly Gly Ile Glu Ile Glu Phe Val Ser Asp 595 600 605 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 691 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (vii) IMMEDIATE SOURCE: (B) CLONE: BPO1 clone of broad bean leaf polyphenol (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..621 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3 TTT TAC GAT GAG AAC AAG AAT CTT GTT AGG GTT AAT GTG AAG GAC AGT 48 Phe Tyr Asp Glu Asn Lys Asn Leu Val Arg Val Asn Val Lys Asp Ser 1 5 10 15 CTT GAC ACA GAA AAA CTA GGT TAT GCT TAT CAA AAT GTT CCC ATT CCA 96 Leu Asp Thr Glu Lys Leu Gly Tyr Ala Tyr Gln Asn Val Pro Ile Pro 20 25 30 TGG GAA AAT GCT AAA CCT GTG CCA CGA AGA ACA AAA GTA CCA AAA TTG 144 Trp Glu Asn Ala Lys Pro Val Pro Arg Arg Thr Lys Val Pro Lys Leu 35 40 45 GTG GAA GTT GAG GTT AAT GAT GGA AAC TTA AGA AAA TCA CCG ACT ATC 192 Val Glu Val Glu Val Asn Asp Gly Asn Leu Arg Lys Ser Pro Thr Ile 50 55 60 TTA AAA GTT CGA CAA CAG AGT CCA AGA AAA TAC GTT ACG TTT CCA TTG 240 Leu Lys Val Arg Gln Gln Ser Pro Arg Lys Tyr Val Thr Phe Pro Leu 65 70 75 80 GTT TTG AAT AAT ACA GTG AGT GCT ATT GTG AAG AGG CCA AAG AAA TCA 288 Val Leu Asn Asn Thr Val Ser Ala Ile Val Lys Arg Pro Lys Lys Ser 85 90 95 AGG AGC AAG AAA GAG AAG GAA GAA GAG GAA GAG GTT TTA GTG ATT GAG 336 Arg Ser Lys Lys Glu Lys Glu Glu Glu Glu Glu Val Leu Val Ile Glu 100 105 110 GGG ATT GAG TTT GAT ATG AAT ATA GCC ATT AAG TTT GAT GTT TAT ATT 384 Gly Ile Glu Phe Asp Met Asn Ile Ala Ile Lys Phe Asp Val Tyr Ile 115 120 125 AAT GAT GAA GAT GCT AAG GTT GGG CCA GGG AAT ACT GAG TTT GCT GGA 432 Asn Asp Glu Asp Ala Lys Val Gly Pro Gly Asn Thr Glu Phe Ala Gly 130 135 140 AGC TTT GTG AAT GTC CCT CAT TCC TCA CAT GGA CAC AGT AAC AAG ATT 480 Ser Phe Val Asn Val Pro His Ser Ser His Gly His Ser Asn Lys Ile 145 150 155 160 ATT ACT TGT TTA AGA CTT GGT ATA ACT GAT TTG TTG GAA GAT TTG GAT 528 Ile Thr Cys Leu Arg Leu Gly Ile Thr Asp Leu Leu Glu Asp Leu Asp 165 170 175 GTC GAA GGC GAT GAT AAT ATT GTG GTT ACA TTG GTT CCA AAA TGT GGG 576 Val Glu Gly Asp Asp Asn Ile Val Val Thr Leu Val Pro Lys Cys Gly 180 185 190 AAT GGA CAA GTC AAA ATC AAT AAC GTC GAG ATA GTG TTT GAA GAT 621 Asn Gly Gln Val Lys Ile Asn Asn Val Glu Ile Val Phe Glu Asp 195 200 205 TGAAAATTTC TACCACTTTG TTATGCACCG TCTGTGTTGA GCGACTTGAG AGGTAGATTT 681 TATGTTTTTT 691 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 207 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4 Phe Tyr Asp Glu Asn Lys Asn Leu Val Arg Val Asn Val Lys Asp Ser 1 5 10 15 Leu Asp Thr Glu Lys Leu Gly Tyr Ala Tyr Gln Asn Val Pro Ile Pro 20 25 30 Trp Glu Asn Ala Lys Pro Val Pro Arg Arg Thr Lys Val Pro Lys Leu 35 40 45 Val Glu Val Glu Val Asn Asp Gly Asn Leu Arg Lys Ser Pro Thr Ile 50 55 60 Leu Lys Val Arg Gln Gln Ser Pro Arg Lys Tyr Val Thr Phe Pro Leu 65 70 75 80 Val Leu Asn Asn Thr Val Ser Ala Ile Val Lys Arg Pro Lys Lys Ser 85 90 95 Arg Ser Lys Lys Glu Lys Glu Glu Glu Glu Glu Val Leu Val Ile Glu 100 105 110 Gly Ile Glu Phe Asp Met Asn Ile Ala Ile Lys Phe Asp Val Tyr Ile 115 120 125 Asn Asp Glu Asp Ala Lys Val Gly Pro Gly Asn Thr Glu Phe Ala Gly 130 135 140 Ser Phe Val Asn Val Pro His Ser Ser His Gly His Ser Asn Lys Ile 145 150 155 160 Ile Thr Cys Leu Arg Leu Gly Ile Thr Asp Leu Leu Glu Asp Leu Asp 165 170 175 Val Glu Gly Asp Asp Asn Ile Val Val Thr Leu Val Pro Lys Cys Gly 180 185 190 Asn Gly Gln Val Lys Ile Asn Asn Val Glu Ile Val Phe Glu Asp 195 200 205 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 204 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (vii) IMMEDIATE SOURCE: (B) CLONE: pSR7 clone encoding apple fruit PPO (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..204 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5 GAG GAC ATG GGG AAC TTT TAC TCC GCC GGT CGG GAT CCC CTG TTT TAC 48 Glu Asp Met Gly Asn Phe Tyr Ser Ala Gly Arg Asp Pro Leu Phe Tyr 1 5 10 15 GCC CAC CAT TGC AAC GTG GAC CGC ATG TGG AAC GTT TGG AAA ACC CTC 96 Ala His His Cys Asn Val Asp Arg Met Trp Asn Val Trp Lys Thr Leu 20 25 30 GGA GGC AAG CGC AAG GAC CCC ACC GAC ACC GAT TGG CTT GAC GCT GAG 144 Gly Gly Lys Arg Lys Asp Pro Thr Asp Thr Asp Trp Leu Asp Ala Glu 35 40 45 TTT CTG TTC TAC GAT GAA AAC GCC GAG CTT GTG AGC TGT AAA GTT CGG 192 Phe Leu Phe Tyr Asp Glu Asn Ala Glu Leu Val Ser Cys Lys Val Arg 50 55 60 GAC AGC CTC AAC 204 Asp Ser Leu Asn 65 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 68 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6 Glu Asp Met Gly Asn Phe Tyr Ser Ala Gly Arg Asp Pro Leu Phe Tyr 1 5 10 15 Ala His His Cys Asn Val Asp Arg Met Trp Asn Val Trp Lys Thr Leu 20 25 30 Gly Gly Lys Arg Lys Asp Pro Thr Asp Thr Asp Trp Leu Asp Ala Glu 35 40 45 Phe Leu Phe Tyr Asp Glu Asn Ala Glu Leu Val Ser Cys Lys Val Arg 50 55 60 Asp Ser Leu Asn 65 (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 176 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (vii) IMMEDIATE SOURCE: (B) CLONE: pSR8 clone encoding apple fruit PPO (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..174 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7 GAG GAT ATG GGG AAT TTT TAC TCT GCG GGG AGG GAT CCG CTG TTT TAC 48 Glu Asp Met Gly Asn Phe Tyr Ser Ala Gly Arg Asp Pro Leu Phe Tyr 1 5 10 15 TCT CAC CAT TCC AAC GTG GAC CGC ATG TGG TCT ATA TAT AAA GAT AAG 96 Ser His His Ser Asn Val Asp Arg Met Trp Ser Ile Tyr Lys Asp Lys 20 25 30 TTG GGA GGT ACG GAC ATA GAA AAA TAC CGA CTG CTG GAC GCA GAG TTC 144 Leu Gly Gly Thr Asp Ile Glu Lys Tyr Arg Leu Leu Asp Ala Glu Phe 35 40 45 TTA TTC TAC GAC GAG AAC AAG AAT CTT CGT GC 176 Leu Phe Tyr Asp Glu Asn Lys Asn Leu Arg 50 55 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 58 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8 Glu Asp Met Gly Asn Phe Tyr Ser Ala Gly Arg Asp Pro Leu Phe Tyr 1 5 10 15 Ser His His Ser Asn Val Asp Arg Met Trp Ser Ile Tyr Lys Asp Lys 20 25 30 Leu Gly Gly Thr Asp Ile Glu Lys Tyr Arg Leu Leu Asp Ala Glu Phe 35 40 45 Leu Phe Tyr Asp Glu Asn Lys Asn Leu Arg 50 55 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1325 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (vii) IMMEDIATE SOURCE: (B) CLONE: pSRP32 clone encoding potato tuber PPO (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1323 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9 TTT TTG CCG TTT CAT CGA TGG TAC TTG TAC TTC CAC GAG AGA ATC GTG 48 Phe Leu Pro Phe His Arg Trp Tyr Leu Tyr Phe His Glu Arg Ile Val 1 5 10 15 GGA AAA TTC ATT GAT GAT CCA ACT TTC GCT TTA CCA TAT TGG AAT TGG 96 Gly Lys Phe Ile Asp Asp Pro Thr Phe Ala Leu Pro Tyr Trp Asn Trp 20 25 30 GAC CAT CCA AAA GGT ATG CGT TTT CCT GCC ATG TAT GAT CGT GAA GGG 144 Asp His Pro Lys Gly Met Arg Phe Pro Ala Met Tyr Asp Arg Glu Gly 35 40 45 ACT TCC CTT TTC GAT GTA ACA CGT GAC CAA AGT CAC CGA AAT GGA GCA 192 Thr Ser Leu Phe Asp Val Thr Arg Asp Gln Ser His Arg Asn Gly Ala 50 55 60 GTA ATC GAT CTT GGT TTT TTC GGC AAT GAA GTT GAA ACA ACT CAA CTC 240 Val Ile Asp Leu Gly Phe Phe Gly Asn Glu Val Glu Thr Thr Gln Leu 65 70 75 80 CAG TTG ATG AGC AAT AAT TTA ACA CTA ATG TAC CGT CAA ATG GTA ACT 288 Gln Leu Met Ser Asn Asn Leu Thr Leu Met Tyr Arg Gln Met Val Thr 85 90 95 AAT GCT CCA TGT CCT CGG ATG TTC TTT GGC GGG CCT TAT GAT CTC GGG 336 Asn Ala Pro Cys Pro Arg Met Phe Phe Gly Gly Pro Tyr Asp Leu Gly 100 105 110 GTT AAC ACT GAA CTC CCG GGA ACT ATA GAA AAC ATC CCT CAC GGT CCT 384 Val Asn Thr Glu Leu Pro Gly Thr Ile Glu Asn Ile Pro His Gly Pro 115 120 125 GTC CAC ATC TGG TCT GGT ACA GTG AGA GGT TCA ACT TTG CCC AAT GGT 432 Val His Ile Trp Ser Gly Thr Val Arg Gly Ser Thr Leu Pro Asn Gly 130 135 140 GCA ATA TCA AAC GGT GAG AAT ATG GGT CAT TTT TAC TCA GCT GGT TTG 480 Ala Ile Ser Asn Gly Glu Asn Met Gly His Phe Tyr Ser Ala Gly Leu 145 150 155 160 GAC CCG GTT TTC TTT TGC CAT CAC AGC AAT GTG GAT CGG ATG TGG AGC 528 Asp Pro Val Phe Phe Cys His His Ser Asn Val Asp Arg Met Trp Ser 165 170 175 GAA TGG AAA GCG ACA GGA GGG AAA AGA ACG GAT ATC ACA CAT AAA GAT 576 Glu Trp Lys Ala Thr Gly Gly Lys Arg Thr Asp Ile Thr His Lys Asp 180 185 190 TGG TTG AAC TCC GAG TTC TTT TTC TAT GAT GAA AAT GAA AAC CCT TAC 624 Trp Leu Asn Ser Glu Phe Phe Phe Tyr Asp Glu Asn Glu Asn Pro Tyr 195 200 205 CGT GTG AAA GTC AGA GAC TGT TTG GAC ACG AAG AAG ATG GGA TAC GAT 672 Arg Val Lys Val Arg Asp Cys Leu Asp Thr Lys Lys Met Gly Tyr Asp 210 215 220 TAC AAA CCA ATT GCC ACA CCA TGG CGT AAC TTC AAG CCC TTA ACA AAG 720 Tyr Lys Pro Ile Ala Thr Pro Trp Arg Asn Phe Lys Pro Leu Thr Lys 225 230 235 240 CCT TCA GCT GGA AAA GTG AAT ACA GCT TCA CTT CCG CCA GCT AGC AAT 768 Pro Ser Ala Gly Lys Val Asn Thr Ala Ser Leu Pro Pro Ala Ser Asn 245 250 255 GTA TTC CCA TTG GCT AAA CTC GAC AAA GCA ATT TCG TTT TCC ATC AAT 816 Val Phe Pro Leu Ala Lys Leu Asp Lys Ala Ile Ser Phe Ser Ile Asn 260 265 270 AGG CCG ACT TCG TCA AGG ACT CAA CAA GAG AAA AAT GCA CAA GAG GAG 864 Arg Pro Thr Ser Ser Arg Thr Gln Gln Glu Lys Asn Ala Gln Glu Glu 275 280 285 ATG TTG ACA TTC AGT AGC ATA AGA TAT GAT AAC AGA GGG TAC ATA AGG 912 Met Leu Thr Phe Ser Ser Ile Arg Tyr Asp Asn Arg Gly Tyr Ile Arg 290 295 300 TTC GAT GTG TTT TCG AAC GTG GAC AAT AAT GTG AAT GCG AAT GAG CTT 960 Phe Asp Val Phe Ser Asn Val Asp Asn Asn Val Asn Ala Asn Glu Leu 305 310 315 320 GAC AAG GCG GAG TTT GCG GGG AGT TAT ACA AGT TTG CCA CAT GTT CAT 1008 Asp Lys Ala Glu Phe Ala Gly Ser Tyr Thr Ser Leu Pro His Val His 325 330 335 AGA GCT GGT GAG ACT AAT CAT ATC GCG ACT GTT GAT TTC CAG CTG GCG 1056 Arg Ala Gly Glu Thr Asn His Ile Ala Thr Val Asp Phe Gln Leu Ala 340 345 350 ATA ACG GAA CTG TTG GAG GAT ATT GGT TTG GAA GAT GAA GAT ACT ATT 1104 Ile Thr Glu Leu Leu Glu Asp Ile Gly Leu Glu Asp Glu Asp Thr Ile 355 360 365 GCG GTG ACT CTG GTG CCA AAG AGA GGT GGT GAA GGT ATC TCC ATT GAA 1152 Ala Val Thr Leu Val Pro Lys Arg Gly Gly Glu Gly Ile Ser Ile Glu 370 375 380 GGT GCG ACG ATC AGT CTT GCA GAT TGT TAA TTA GTC TCT ATT GAA TCT 1200 Gly Ala Thr Ile Ser Leu Ala Asp Cys Xaa Leu Val Ser Ile Glu Ser 385 390 395 400 GCT GAG ATT ACA CTT TGA TGG ATG ATG CTC TGT TTT TGT TTT CTT GTT 1248 Ala Glu Ile Thr Leu Xaa Trp Met Met Leu Cys Phe Cys Phe Leu Val 405 410 415 CTG TTT TTT CCT CTG TTG AAA TCA GCT TTG TTG CTT GAT TTC ATT GAA 1296 Leu Phe Phe Pro Leu Leu Lys Ser Ala Leu Leu Leu Asp Phe Ile Glu 420 425 430 GTT GTT ATT CAA GAA TAA ATC AGT TAC AA 1325 Val Val Ile Gln Glu Xaa Ile Ser Tyr 435 440 (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 441 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10 Phe Leu Pro Phe His Arg Trp Tyr Leu Tyr Phe His Glu Arg Ile Val 1 5 10 15 Gly Lys Phe Ile Asp Asp Pro Thr Phe Ala Leu Pro Tyr Trp Asn Trp 20 25 30 Asp His Pro Lys Gly Met Arg Phe Pro Ala Met Tyr Asp Arg Glu Gly 35 40 45 Thr Ser Leu Phe Asp Val Thr Arg Asp Gln Ser His Arg Asn Gly Ala 50 55 60 Val Ile Asp Leu Gly Phe Phe Gly Asn Glu Val Glu Thr Thr Gln Leu 65 70 75 80 Gln Leu Met Ser Asn Asn Leu Thr Leu Met Tyr Arg Gln Met Val Thr 85 90 95 Asn Ala Pro Cys Pro Arg Met Phe Phe Gly Gly Pro Tyr Asp Leu Gly 100 105 110 Val Asn Thr Glu Leu Pro Gly Thr Ile Glu Asn Ile Pro His Gly Pro 115 120 125 Val His Ile Trp Ser Gly Thr Val Arg Gly Ser Thr Leu Pro Asn Gly 130 135 140 Ala Ile Ser Asn Gly Glu Asn Met Gly His Phe Tyr Ser Ala Gly Leu 145 150 155 160 Asp Pro Val Phe Phe Cys His His Ser Asn Val Asp Arg Met Trp Ser 165 170 175 Glu Trp Lys Ala Thr Gly Gly Lys Arg Thr Asp Ile Thr His Lys Asp 180 185 190 Trp Leu Asn Ser Glu Phe Phe Phe Tyr Asp Glu Asn Glu Asn Pro Tyr 195 200 205 Arg Val Lys Val Arg Asp Cys Leu Asp Thr Lys Lys Met Gly Tyr Asp 210 215 220 Tyr Lys Pro Ile Ala Thr Pro Trp Arg Asn Phe Lys Pro Leu Thr Lys 225 230 235 240 Pro Ser Ala Gly Lys Val Asn Thr Ala Ser Leu Pro Pro Ala Ser Asn 245 250 255 Val Phe Pro Leu Ala Lys Leu Asp Lys Ala Ile Ser Phe Ser Ile Asn 260 265 270 Arg Pro Thr Ser Ser Arg Thr Gln Gln Glu Lys Asn Ala Gln Glu Glu 275 280 285 Met Leu Thr Phe Ser Ser Ile Arg Tyr Asp Asn Arg Gly Tyr Ile Arg 290 295 300 Phe Asp Val Phe Ser Asn Val Asp Asn Asn Val Asn Ala Asn Glu Leu 305 310 315 320 Asp Lys Ala Glu Phe Ala Gly Ser Tyr Thr Ser Leu Pro His Val His 325 330 335 Arg Ala Gly Glu Thr Asn His Ile Ala Thr Val Asp Phe Gln Leu Ala 340 345 350 Ile Thr Glu Leu Leu Glu Asp Ile Gly Leu Glu Asp Glu Asp Thr Ile 355 360 365 Ala Val Thr Leu Val Pro Lys Arg Gly Gly Glu Gly Ile Ser Ile Glu 370 375 380 Gly Ala Thr Ile Ser Leu Ala Asp Cys Xaa Leu Val Ser Ile Glu Ser 385 390 395 400 Ala Glu Ile Thr Leu Xaa Trp Met Met Leu Cys Phe Cys Phe Leu Val 405 410 415 Leu Phe Phe Pro Leu Leu Lys Ser Ala Leu Leu Leu Asp Phe Ile Glu 420 425 430 Val Val Ile Gln Glu Xaa Ile Ser Tyr 435 440 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1315 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (vii) IMMEDIATE SOURCE: (B) CLONE: pSRP33 clone encoding potato tuber PPO (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1314 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11 TTC TTG CCG TTC CAC CGA TGG TAC TTA TAC TTC TAC GAG AGA ATA TTG 48 Phe Leu Pro Phe His Arg Trp Tyr Leu Tyr Phe Tyr Glu Arg Ile Leu 1 5 10 15 GGA AAA CTC ATC GAT GAT CCA ACT TTC GCT TTA CCA TAT TGG AAT TGG 96 Gly Lys Leu Ile Asp Asp Pro Thr Phe Ala Leu Pro Tyr Trp Asn Trp 20 25 30 GAT CAT CCA AAG GGC ATG CGT TTA CCT CCC ATG TTC GAT CGT GAA GGA 144 Asp His Pro Lys Gly Met Arg Leu Pro Pro Met Phe Asp Arg Glu Gly 35 40 45 ACT TCT ATT TAC GAC GAA AGG CGT AAT CAA CAA GTC CGT AAC GGA ACC 192 Thr Ser Ile Tyr Asp Glu Arg Arg Asn Gln Gln Val Arg Asn Gly Thr 50 55 60 GTT ATG GAT CTT GGT TCA TTT GGG GAC AAG GTC CAA ACA ACT CAA CTC 240 Val Met Asp Leu Gly Ser Phe Gly Asp Lys Val Gln Thr Thr Gln Leu 65 70 75 80 CAG TTG ATG AGC AAT AAT TTA ACA CTA ATG TAC CGT CAA ATG GTA ACT 288 Gln Leu Met Ser Asn Asn Leu Thr Leu Met Tyr Arg Gln Met Val Thr 85 90 95 AAT GCT CCA TGT CCT CTT TTG TTC TTC GGT GCG CCT TAC GTT CTT GGG 336 Asn Ala Pro Cys Pro Leu Leu Phe Phe Gly Ala Pro Tyr Val Leu Gly 100 105 110 AAT AAC GTC GAA GCC CCG GGA ACC ATT GAA AAC ATC CCT CAT ATA CCT 384 Asn Asn Val Glu Ala Pro Gly Thr Ile Glu Asn Ile Pro His Ile Pro 115 120 125 GTC CAT ATT TGG GCT GGT ACA GTA CGT GGT TCA ACA TTT CCT AAT GGT 432 Val His Ile Trp Ala Gly Thr Val Arg Gly Ser Thr Phe Pro Asn Gly 130 135 140 GAT ACG TCA TAC GGT GAG GAT ATG GGT AAT TTC TAC TCA GCT GGT TTA 480 Asp Thr Ser Tyr Gly Glu Asp Met Gly Asn Phe Tyr Ser Ala Gly Leu 145 150 155 160 GAC CCG GTT TTC TAT TGC CAC CAC GGC AAT GTG GAC CGT ATG TGG AAT 528 Asp Pro Val Phe Tyr Cys His His Gly Asn Val Asp Arg Met Trp Asn 165 170 175 GAA TGG AAG GCA ATA GGA GGT AAG AGA AGG GAT TTA TCA GAA AAA GAT 576 Glu Trp Lys Ala Ile Gly Gly Lys Arg Arg Asp Leu Ser Glu Lys Asp 180 185 190 TGG TTG AAC TCT GAG TTC TTC TTT TAT GAT GAA AAC AAA AAG CCT TAC 624 Trp Leu Asn Ser Glu Phe Phe Phe Tyr Asp Glu Asn Lys Lys Pro Tyr 195 200 205 CGT GTG AAA GTC CGA GAC TGT TTG GAC GCG AAG AAA ATG GGG TAC GAT 672 Arg Val Lys Val Arg Asp Cys Leu Asp Ala Lys Lys Met Gly Tyr Asp 210 215 220 TAC GCA CCA ATG CCA ACT CCA TGG CGT AAC TTC AAA CCA AAA ACA AAG 720 Tyr Ala Pro Met Pro Thr Pro Trp Arg Asn Phe Lys Pro Lys Thr Lys 225 230 235 240 GCA TCA GTA GGG AAA GTG AAT ACA ACT ACA CTC CCC CCA GTG AAC AAG 768 Ala Ser Val Gly Lys Val Asn Thr Thr Thr Leu Pro Pro Val Asn Lys 245 250 255 GTA TTC CCA CTC ACG AAG ATG GAT AAA GCC ATT TCA TTT TCC ATC AAT 816 Val Phe Pro Leu Thr Lys Met Asp Lys Ala Ile Ser Phe Ser Ile Asn 260 265 270 AGG CCT GCT TCA TCG CGG ACT CAA CAA GAG AAA AAT GAA CAA GAG GAG 864 Arg Pro Ala Ser Ser Arg Thr Gln Gln Glu Lys Asn Glu Gln Glu Glu 275 280 285 ATG TTA ACG TTC GAT AAC ATA AAA TAT GAT AAT AGA GGG TAT ATA AGG 912 Met Leu Thr Phe Asp Asn Ile Lys Tyr Asp Asn Arg Gly Tyr Ile Arg 290 295 300 TTC GAT GTA TTT CTG AAC GTG GAT AAC AAT GTG AAT GCG AAT GAG CTT 960 Phe Asp Val Phe Leu Asn Val Asp Asn Asn Val Asn Ala Asn Glu Leu 305 310 315 320 GAT AAG GCA GAG TTC GCG GGG AGT TAT ACT AGT TTG CCA CAT GTT CAC 1008 Asp Lys Ala Glu Phe Ala Gly Ser Tyr Thr Ser Leu Pro His Val His 325 330 335 AGA GTT GGC GAG AAT GAT CAT ACC GCG ACT GTT ACT TTC CAG CTG GCG 1056 Arg Val Gly Glu Asn Asp His Thr Ala Thr Val Thr Phe Gln Leu Ala 340 345 350 ATA ACA GAA CTG TTG GAG GAC ATT GGT TTG GAA GAT GAA GAG ACT ATT 1104 Ile Thr Glu Leu Leu Glu Asp Ile Gly Leu Glu Asp Glu Glu Thr Ile 355 360 365 GCG GTG ACT CTG GTA CCA AAG AAA GGT GGT GAA GGT ATC TCC ATT GAA 1152 Ala Val Thr Leu Val Pro Lys Lys Gly Gly Glu Gly Ile Ser Ile Glu 370 375 380 AAT GTG GAG ATC AAG CTT CTG GAT TGT TAA GTA CGT TCT CAA TTG AAT 1200 Asn Val Glu Ile Lys Leu Leu Asp Cys Xaa Val Arg Ser Gln Leu Asn 385 390 395 400 CTG CTG AGA TTA CAA CTT TGA TAT GTT TTT TAC TTT TGT TTT TCC ATG 1248 Leu Leu Arg Leu Gln Leu Xaa Tyr Val Phe Tyr Phe Cys Phe Ser Met 405 410 415 TAA CTT TTC CTG TTG AAA TCA GCT TGA TGC TTG ATT TCC TTG GAG TTG 1296 Xaa Leu Phe Leu Leu Lys Ser Ala Xaa Cys Leu Ile Ser Leu Glu Leu 420 425 430 TTA TTC ACT AAT AAA ATC A 1315 Leu Phe Thr Asn Lys Ile 435 (2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 438 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12 Phe Leu Pro Phe His Arg Trp Tyr Leu Tyr Phe Tyr Glu Arg Ile Leu 1 5 10 15 Gly Lys Leu Ile Asp Asp Pro Thr Phe Ala Leu Pro Tyr Trp Asn Trp 20 25 30 Asp His Pro Lys Gly Met Arg Leu Pro Pro Met Phe Asp Arg Glu Gly 35 40 45 Thr Ser Ile Tyr Asp Glu Arg Arg Asn Gln Gln Val Arg Asn Gly Thr 50 55 60 Val Met Asp Leu Gly Ser Phe Gly Asp Lys Val Gln Thr Thr Gln Leu 65 70 75 80 Gln Leu Met Ser Asn Asn Leu Thr Leu Met Tyr Arg Gln Met Val Thr 85 90 95 Asn Ala Pro Cys Pro Leu Leu Phe Phe Gly Ala Pro Tyr Val Leu Gly 100 105 110 Asn Asn Val Glu Ala Pro Gly Thr Ile Glu Asn Ile Pro His Ile Pro 115 120 125 Val His Ile Trp Ala Gly Thr Val Arg Gly Ser Thr Phe Pro Asn Gly 130 135 140 Asp Thr Ser Tyr Gly Glu Asp Met Gly Asn Phe Tyr Ser Ala Gly Leu 145 150 155 160 Asp Pro Val Phe Tyr Cys His His Gly Asn Val Asp Arg Met Trp Asn 165 170 175 Glu Trp Lys Ala Ile Gly Gly Lys Arg Arg Asp Leu Ser Glu Lys Asp 180 185 190 Trp Leu Asn Ser Glu Phe Phe Phe Tyr Asp Glu Asn Lys Lys Pro Tyr 195 200 205 Arg Val Lys Val Arg Asp Cys Leu Asp Ala Lys Lys Met Gly Tyr Asp 210 215 220 Tyr Ala Pro Met Pro Thr Pro Trp Arg Asn Phe Lys Pro Lys Thr Lys 225 230 235 240 Ala Ser Val Gly Lys Val Asn Thr Thr Thr Leu Pro Pro Val Asn Lys 245 250 255 Val Phe Pro Leu Thr Lys Met Asp Lys Ala Ile Ser Phe Ser Ile Asn 260 265 270 Arg Pro Ala Ser Ser Arg Thr Gln Gln Glu Lys Asn Glu Gln Glu Glu 275 280 285 Met Leu Thr Phe Asp Asn Ile Lys Tyr Asp Asn Arg Gly Tyr Ile Arg 290 295 300 Phe Asp Val Phe Leu Asn Val Asp Asn Asn Val Asn Ala Asn Glu Leu 305 310 315 320 Asp Lys Ala Glu Phe Ala Gly Ser Tyr Thr Ser Leu Pro His Val His 325 330 335 Arg Val Gly Glu Asn Asp His Thr Ala Thr Val Thr Phe Gln Leu Ala 340 345 350 Ile Thr Glu Leu Leu Glu Asp Ile Gly Leu Glu Asp Glu Glu Thr Ile 355 360 365 Ala Val Thr Leu Val Pro Lys Lys Gly Gly Glu Gly Ile Ser Ile Glu 370 375 380 Asn Val Glu Ile Lys Leu Leu Asp Cys Xaa Val Arg Ser Gln Leu Asn 385 390 395 400 Leu Leu Arg Leu Gln Leu Xaa Tyr Val Phe Tyr Phe Cys Phe Ser Met 405 410 415 Xaa Leu Phe Leu Leu Lys Ser Ala Xaa Cys Leu Ile Ser Leu Glu Leu 420 425 430 Leu Phe Thr Asn Lys Ile 435 (2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 892 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (vii) IMMEDIATE SOURCE: (B) CLONE: pID5RACE4 clone encoding potato tuber PPO (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 28..891 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13 TTTTTTTTTA TTCAAAAGCT AGCAATA ATG GCA AGC TTG TGC AAT AGT TGT 51 Met Ala Ser Leu Cys Asn Ser Cys 1 5 AGT ACA TCC CTC AAA ACT CCT TTT ACT TCT TCC TCC ACT TCT TTA ACT 99 Ser Thr Ser Leu Lys Thr Pro Phe Thr Ser Ser Ser Thr Ser Leu Thr 10 15 20 TCC ACT CCT AAA CCC TCT CAA CTT TTC ATC CAT GGA AAA CGT AAC CAA 147 Ser Thr Pro Lys Pro Ser Gln Leu Phe Ile His Gly Lys Arg Asn Gln 25 30 35 40 ATG TTC AAA GTT TCA TGC ATG GTT ACC AAT AAT AAC GGT GAC CAA AAC 195 Met Phe Lys Val Ser Cys Met Val Thr Asn Asn Asn Gly Asp Gln Asn 45 50 55 CAA AAC GTT GAA ACG AAT TCT GTT GAT CGA AGA AAT GTT CTT CTT GGC 243 Gln Asn Val Glu Thr Asn Ser Val Asp Arg Arg Asn Val Leu Leu Gly 60 65 70 TTA GGT GGT CTT TAT GGT GTT GCT AAT GCT ATA CCA TTA GCT GCA TCC 291 Leu Gly Gly Leu Tyr Gly Val Ala Asn Ala Ile Pro Leu Ala Ala Ser 75 80 85 GCT ACT CCA TCT CCA CCT CCT GAT CTC TCG TCT TGT AGT ATA GCC AGG 339 Ala Thr Pro Ser Pro Pro Pro Asp Leu Ser Ser Cys Ser Ile Ala Arg 90 95 100 ATT AAC GAA ACT CAT GTG GTG CCG TAC AGT TGT TGC GCG CCT AAG CCT 387 Ile Asn Glu Thr His Val Val Pro Tyr Ser Cys Cys Ala Pro Lys Pro 105 110 115 120 GAT GAT ATG GAG AAA GTT CCG TAT TAC AAG TTC CCT TCT ATG ACT AAG 435 Asp Asp Met Glu Lys Val Pro Tyr Tyr Lys Phe Pro Ser Met Thr Lys 125 130 135 CTC CGT GTT CGT CAG CCT GCT CAT GAA GCT AAT GAG GAG TAT ATT GCC 483 Leu Arg Val Arg Gln Pro Ala His Glu Ala Asn Glu Glu Tyr Ile Ala 140 145 150 AAG TAC AAT TTG GCG GTT AGC AAG ATG AGG GAT CTT GAT AAG ACA CAA 531 Lys Tyr Asn Leu Ala Val Ser Lys Met Arg Asp Leu Asp Lys Thr Gln 155 160 165 CCT TTA AAC CCT ATT GGT TTT AAG CAA CAA GCT AAT ATA CAT TGT GCT 579 Pro Leu Asn Pro Ile Gly Phe Lys Gln Gln Ala Asn Ile His Cys Ala 170 175 180 TAT TGT AAC GGT GCT TAT AGA ATT GGT GGC AAA GAG TTA CAA GTT CAT 627 Tyr Cys Asn Gly Ala Tyr Arg Ile Gly Gly Lys Glu Leu Gln Val His 185 190 195 200 AAT TCT TGG CTT TTC TTC CCG TTC CAT AGA TGG TAC TTG TAC TTC TAC 675 Asn Ser Trp Leu Phe Phe Pro Phe His Arg Trp Tyr Leu Tyr Phe Tyr 205 210 215 GAG AGA ATC GTG GGA AAA TTC ATT GAT GAT GCA ACT TTC GCT TTG CCA 723 Glu Arg Ile Val Gly Lys Phe Ile Asp Asp Ala Thr Phe Ala Leu Pro 220 225 230 TAT TGG AAT TGG GAC CAT CCA AAG GGT ATG CGT TTT CCT GCC ATG TAT 771 Tyr Trp Asn Trp Asp His Pro Lys Gly Met Arg Phe Pro Ala Met Tyr 235 240 245 GAT CGT GAA GGG ACT TCC CTT TTC GAT GTA ACA CGT GAC CAA AGT CAC 819 Asp Arg Glu Gly Thr Ser Leu Phe Asp Val Thr Arg Asp Gln Ser His 250 255 260 CGA AAT GGA GCA GTA ATC GAT CTT GGT TTT ATC GGC AAT GAA GTC GAA 867 Arg Asn Gly Ala Val Ile Asp Leu Gly Phe Ile Gly Asn Glu Val Glu 265 270 275 280 ACA ACT CAA CTC CAG TTG ATG AGC A 892 Thr Thr Gln Leu Gln Leu Met Ser 285 (2) INFORMATION FOR SEQ ID NO: 14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 288 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14 Met Ala Ser Leu Cys Asn Ser Cys Ser Thr Ser Leu Lys Thr Pro Phe 1 5 10 15 Thr Ser Ser Ser Thr Ser Leu Thr Ser Thr Pro Lys Pro Ser Gln Leu 20 25 30 Phe Ile His Gly Lys Arg Asn Gln Met Phe Lys Val Ser Cys Met Val 35 40 45 Thr Asn Asn Asn Gly Asp Gln Asn Gln Asn Val Glu Thr Asn Ser Val 50 55 60 Asp Arg Arg Asn Val Leu Leu Gly Leu Gly Gly Leu Tyr Gly Val Ala 65 70 75 80 Asn Ala Ile Pro Leu Ala Ala Ser Ala Thr Pro Ser Pro Pro Pro Asp 85 90 95 Leu Ser Ser Cys Ser Ile Ala Arg Ile Asn Glu Thr His Val Val Pro 100 105 110 Tyr Ser Cys Cys Ala Pro Lys Pro Asp Asp Met Glu Lys Val Pro Tyr 115 120 125 Tyr Lys Phe Pro Ser Met Thr Lys Leu Arg Val Arg Gln Pro Ala His 130 135 140 Glu Ala Asn Glu Glu Tyr Ile Ala Lys Tyr Asn Leu Ala Val Ser Lys 145 150 155 160 Met Arg Asp Leu Asp Lys Thr Gln Pro Leu Asn Pro Ile Gly Phe Lys 165 170 175 Gln Gln Ala Asn Ile His Cys Ala Tyr Cys Asn Gly Ala Tyr Arg Ile 180 185 190 Gly Gly Lys Glu Leu Gln Val His Asn Ser Trp Leu Phe Phe Pro Phe 195 200 205 His Arg Trp Tyr Leu Tyr Phe Tyr Glu Arg Ile Val Gly Lys Phe Ile 210 215 220 Asp Asp Ala Thr Phe Ala Leu Pro Tyr Trp Asn Trp Asp His Pro Lys 225 230 235 240 Gly Met Arg Phe Pro Ala Met Tyr Asp Arg Glu Gly Thr Ser Leu Phe 245 250 255 Asp Val Thr Arg Asp Gln Ser His Arg Asn Gly Ala Val Ile Asp Leu 260 265 270 Gly Phe Ile Gly Asn Glu Val Glu Thr Thr Gln Leu Gln Leu Met Ser 275 280 285 (2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15 GACTCGAGTC GACATCGATT TTTTTTTTTT TTTTT 35 (2) INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16 GACTCGAGTC GACATCG 17 (2) INFORMATION FOR SEQ ID NO: 17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE: (B) CLONE: Primer utilized for amplification of grape (ix) FEATURE: (A) NAME/KEY: modified_base (B) LOCATION: 3..24 (D) OTHER INFORMATION: /mod_base= i (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17 CCNATNCAGG CNCCNGATAT NNCNAAGTGT GG 32 (2) INFORMATION FOR SEQ ID NO: 18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE: (B) CLONE: Primer utilized for amplification of bean (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18 GCGGATCCTT YTAYGAYGAR AAYAA 25 (2) INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE: (B) CLONE: Primer utilized for amplification of apple (ix) FEATURE: (A) NAME/KEY: modified_base (B) LOCATION: 20 (D) OTHER INFORMATION: /mod_base= i (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19 GCGAATTCGA RGAYATGGGN AAYTTYTA 28 (2) INFORMATION FOR SEQ ID NO: 20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: modified_base (B) LOCATION: 14..17 (D) OTHER INFORMATION: /mod_base= i (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20 GCGAATTCTT YYTNCCNTTY CAYMG 25 (2) INFORMATION FOR SEQ ID NO: 21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: modified_base (B) LOCATION: 14..20 (D) OTHER INFORMATION: /mod_base= i (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21 GCGAATTCAA YGTNGAYMGN ATGTGG 26 (2) INFORMATION FOR SEQ ID NO: 22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22 AATCTTTGTG GTGACTGGCG 20 (2) INFORMATION FOR SEQ ID NO: 23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23 GACGGTACAT TAGTCTTAAA T 21 (2) INFORMATION FOR SEQ ID NO: 24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24 ACCATCAGGC ACGGTGGCGG 20 (2) INFORMATION FOR SEQ ID NO: 25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25 TGCTCATCAA CTGGAGTTGA G 21 (2) INFORMATION FOR SEQ ID NO: 26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26 Ala Pro Ile Gln Ala Pro Asp Ile Ser Lys Cys Gly Thr Ala Thr Val 1 5 10 15 Pro Asp Gly Val Thr Pro 20 (2) INFORMATION FOR SEQ ID NO: 27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27 GACGGTACAT TAGTGTTAAA T 21 * * * * * Field of search:Foreign documents:Other references:References: |
Browse by classes
Agriculture
Animals Automotives and Transportation Business and Commerce Chemistry Communications Construction Containers Electricity Energy Engineering Entertainment Fashion and Accessories Food Hardware and Tools Health and Medicine Home Industrial Information Technology Machines Materials and Material Science Miscellaneous Optics Outdoors Paper and Office Materials Physics Sanitation Technology Textiles Weaponry
Advertisements
|
