Home
Agents
Assignees
Inventors
Examiners
Contact
Links

Method for cloning and expression of Tth111II restriction endonuclease-methylase in E. coli


No:

6919194 -

Application no:

10338731 -

Filed date:

2003-01-08 -

Issue date:

2005-07-19

Kind:

B2


Claims:

5

Drawing sheets:

10

Abstract:


The present invention relates to recombinant DNA which encodes the Tth111II restriction endonuclease-methylase fusion protein (Tth111IIRM), expression of Tth111II restriction endonuclease-methylase fusion protein in E. coli cells containing the recombinant DNA, and purification of Tth111II endonuclease-methylase fusion protein to near homogeneity.

US Classes:



Inventors:



Agents:


Assignees:


Claims:


What is claimed is:

1. Isolated DNA coding for the Tth111II restriction endonuclease-methylase, wherein the isolated DNA is obtainable from Thermus thermophilus 111.

2. A recombinant DNA vector comprising a vector into which a DNA segment encoding the Tth111II restriction endonuclease-methylase gene has been inserted.

3. Isolated DNA encoding the Tth111II restriction endonuclease-methylase, wherein the isolated DNA is obtainable from ATCC No. PTA 4891.

4. A host cell transformed by the vector of claim 2.

5. A method of producing recombinant Tth111II restriction endonuclease-methylase fusion protein comprising culturing a host cell transformed with the vector of claim 2 under conditions suitable for expression of said endonuclease-methylase.

Text:


BACKGROUND OF THE INVENTION

The present invention relates to recombinant DNA encoding the Tth111II restriction endonuclease methylase fusion protein (RM fusion protein), as well as expression of Tth111II RM fusion protein in E. coli cells containing the recombinant DNA.

Tth111II endonuclease is found in the strain of Thermus thermophilus 111 (New England Biolabs' strain collection #249 (Beverly, Mass.)). It recognizes the double-stranded DNA sequence 5'CAARCA3'N11/N9 and cleaves downstream sequence at N11 (top strand) and N9 (bottom strand) to generate a 2-base 3' overhang (/ indicates the cleavage of phosphodiester bond).

Type II restriction endonucleases are a class of enzymes that occur naturally in bacteria and in some viruses. When they are purified away from other bacterial/viral proteins, restriction endonucleases can be used in the laboratory to cleave DNA molecules into small fragments for molecular cloning and gene characterization.

Restriction endonucleases recognize and bind particular sequences of nucleotides (the `recognition sequence`) on DNA molecules. Once bound, they cleave the molecule within (e.g. BamHI), to one side of (e.g. SapI), or to both sides (e.g. TspRI) of the recognition sequence. Different restriction endonucleases have affinity for different recognition sequences. Over two hundred and eleven restriction endonucleases with unique specificities have been identified among the many hundreds of bacterial species that have been examined to date (Roberts and Macelis, Nucl. Acids Res. 27:312-313, (1999)).

Restriction endonucleases typically are named according to the bacteria from which they are discovered. Thus, the species Deinococcus radiophilus for example, produces three different restriction endonucleases, named DraI, DraII and DraIII. These enzymes recognize and cleave the sequences 5'TTT/AAA3', 5'PuG/GNCCPy3' and 5'CACNNN/GTG3', respectively. Escherichia coli RY13, on the other hand, produces only one enzyme, EcoRI, which recognizes the sequence 5'G/AATTC3'.

A second component of bacterial/viral restriction-modification (R-M) systems are the methylase. These enzymes co-exist with restriction endonucleases and they provide the means by which bacteria are able to protect their own DNA and distinguish it from foreign DNA. Modification methylases recognize and bind to the same recognition sequence as the corresponding restriction endonuclease, but instead of cleaving the DNA, they chemically modify one particular nucleotide within the sequence by the addition of a methyl group (C5 methyl cytosine, N4 methyl cytosine, or N6 methyl adenine). Following methylation, the recognition sequence is no longer cleaved by the cognate restriction endonuclease. The DNA of a bacterial cell is always fully modified by the activity of its modification methylase. It is therefore completely insensitive to the presence of the endogenous restriction endonuclease. Only unmodified, and therefore identifiably foreign DNA, is sensitive to restriction endonuclease recognition and cleavage. During and after DNA replication, usually the hemi-methylated DNA (DNA methylated on one strand) is also resistant to the cognate restriction digestion.

With the advancement of recombinant DNA technology, it is now possible to clone genes and overproduce the enzymes in large quantities. The key to isolating clones of restriction endonuclease genes is to develop an efficient method to identify such clones within genomic DNA libraries, i.e. populations of clones derived by `shotgun` procedures, when they occur at frequencies as low as 10.sup.-3 to 10.sup.-4. Preferably, the method should be selective, such that the unwanted clones with non-methylase inserts are destroyed while the desirable rare clones survive.

A large number of type II restriction-modification systems have been cloned. The first cloning method used bacteriophage infection as a means of identifying or selecting restriction endonuclease clones (EcoRII: Kosykh et al., Mol Gen. Genet. 178:717-719, (1980); HhaII: Mann et al., Gene 3:97-112, (1978); PstI: Walder et al., Proc. Nat. Acad. Sci. 78:1503-1507, (1981)). Since the expressions of restriction-modification systems in bacteria enable them to resist infection by bacteriophages, cells that carry cloned restriction-modification genes can, in principle, be selectively isolated as survivors from genomic DNA libraries that have been exposed to phage. However, this method has been found to have only a limited success rate. Specifically, it has been found that cloned restriction-modification genes do not always confer sufficient phage resistance to achieve selective survival.

Another cloning approach involves transferring systems initially characterized as plasmid-borne into E. coli cloning vectors (EcoRV: Bougueleret et al., Nucl. Acids. Res. 12:3659-3676, (1984); PaeR7: Gingeras and Brooks, Proc. Natl. Acad. Sci. USA 80:402-406, (1983); Theriault and Roy, Gene 19:355-359 (1982); PvuII: Blumenthal et al., J. Bacteriol. 164:501-509, (1985); Tsp45I: Wayne et al. Gene 202:83-88, (1997)).

A third approach is to select for active expression of methylase genes (methylase selection) (U.S. Pat. No. 5,200,333 and BsuRI: Kiss et al., Nucl. Acids. Res. 13:6403-6421, (1985)). Since restriction-modification genes are often closely linked together, both genes can often be cloned simultaneously. This selection does not always yield a complete restriction system however, but instead yields only the methylase gene (BspRI: Szomolanyi et al., Gene 10:219-225, (1980); BcnI: Janulaitis et al., Gene 20:197-204 (1982); BsuRI: Kiss and Baldauf, Gene 21:111-119, (1983); and MspI: Walder et al., J. Biol. Chem. 258:1235-1241, (1983)).

A more recent method, the "endo-blue method", has been described for direct cloning of thermostable restriction endonuclease genes into E. coli based on the indicator strain of E. coli containing the dinD::lacZ fusion (Fomenkov et al., U.S. Pat. No. 5,498,535; Fomenkov et al., Nucl. Acids Res. 22:2399-2403, (1994)). This method utilizes the E. coli SOS response signals following DNA damage caused by restriction endonucleases or non-specific nucleases. A number of thermostable nuclease genes (TaqI, Tth111I, BsoBI, TfiI nuclease) have been cloned by this method (U.S. Pat. No. 5,498,535). The disadvantage of this method is that sometimes positive blue clones containing a restriction endonuclease gene are difficult to culture due to the lack of the cognate methylase gene.

There are three major groups of DNA methylases based on the position and the base that is modified (C5 cytosine methylases, N4 cytosine methylases, and N6 adenine methylases). N4 cytosine and N6 adenine methylases are amino-methyltransferases (Malone et al. J. Mol. Biol. 253:618-632, (1995)). When a restriction site on DNA is modified (methylated) by the methylase, it is resistant to digestion by the cognate restriction endonuclease. Sometimes methylation by a non-cognate methylase can also confer the DNA site resistant to restriction digestion. For example, Dcm methylase modification of 5'CCWGG3' (W=A or T) (SEQ ID NO:1) can also make the DNA resistant to PspGI restriction digestion. Another example is that CpG methylase can modify the CG dinucioetide and make the NotI site (5'GCGGCCGC3' (SEQ ID NO:2)) refractory to NotI digestion (New England Biolabs' Catalog, 2000-01, page 220). Therefore methylases can be used as a tool to modify certain DNA sequences and make them uncleavable by restriction enzymes.

Because purified restriction endonucleases and modification methylases are useful tools for creating recombinant molecules in the laboratory, there is a great commercial interest to obtain bacterial strains through recombinant DNA techniques that produce large quantities of restriction enzymes. Such over-expression strains should also simplify the task of enzyme purification.

SUMMARY OF THE INVENTION

The present invention relates to a recombinant DNA encoding the Tth111II as well as related to methods for cloning and producing Tth111II endonuclease-methylase fusion gene from Thermus thermophilus 111 into E. coli by protein sequencing and inverse PCR amplification of the adjacent DNA containing Tth111II restriction endonuclease-methylase fusion gene (Tth111II, Tth111IIR, and Tth111IIRM are used to refer to the same protein).

Native Tth111II was purified from the native strain Thermus thermophilus 111 by chromatography through Heparin sepharose, QHP, Heparin TSK and Poly Cat A. The native Tth111II was purified near homogeneity, it showed only one band on the protein gel and with an apparent molecular weight of 115 kDa. The purified enzyme was sequenced to obtain the N-terminus amino acid sequence.

At first ApoI and NlaIII partial genomic DNA libraries were constructed using the cloning vector pUCKm (Km.sup.R). No methylase positive clones were identified following the methylase selection method. No resistant clones were found in Acc65I, AseI, AvrII, BfaI, BsiWI, BsrGI, MseI, NdeI, NheI, NsiI, NspI, PstI, SacI, SalI, SpeI, SphI, XbaI, and XhoI genomic DNA libraries following Tth111II challenge and retransformation. This negative result suggested that the methylase selection was not strong enough or poor expression of the Tth111II methylase in the cloning host (it was found that the methylase domain is fused with the endonuclease domain, see below in Example I).

The N-terminus of the purified native Tth111II was sequenced, which generated the amino acid sequence of the first twenty residues. According to the amino acid sequence, two pairs of degenerated PCR primers were synthesized and PCR was performed. Direct sequencing of the PCR product with the degenerate primers failed to generate any sequences. PCR product was then phosphorylated with T4 polynucleotide kinase and ligated to the SmaI cut and CIP treated pUC19. Clones with inserts were screened and the plasmids were sequenced and all of inserts were found to be primer dimmer. Another set of PCR primers with BamHI sites incorporated were synthesized and used in PCR. PCR products were cloned into BamHI digested pUC19. Clones with inserts were screened and sequenced. The bona fide DNA coding sequence was obtained although at some nucleotide positions (at priming sites) degenerate bases still exist. Among the 60 bp coding sequence, only the non-priming region (14 bp) does not contain degenerate bases. A pair of inverse PCR primers was designed for the inverse PCR and PCR products were found in AluI, BfaI, BstUI, MspI, NlaIII, and Sau3AI digested templates. The DNA products were gel-purified and sequenced. Another two rounds of inverse PCR and sequencing resulted in the discovery of the entire open reading frame (ORF). The entire ORF was amplified and cloned into the expression vector pET28a and transformed into E. coli ER2744. Active clones with single copy insert with Tth111II activity were sequenced and confirmed to contain the wild type sequence.

During over-expression of the Tth111II in pET28a, two clones displayed high Tth111II activity. Further restriction analysis revealed that the clones contain one complete gene copy and a second copy with deletion in the first 6 bp including the starting codon. The duplication may contribute to the stability and higher expression level and higher Tth111II activity since the second copy with 6-bp deletion may abolish the endonuclease activity while it still maintains the methylase activity.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Nucleotide sequence of the N-terminus coding sequence of tth111IIR gene. Clones 1-16: 16 sequenced isolates (SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18). Con: consensus sequence (SEQ ID No:19), WT (SEQ ID No:20): bona fide coding sequence of the tth111IIR gene. The nucleotide in bold is 100% identity in all sequenced isolates.

FIG. 2. DNA sequence of Tth111II endonuclease-methylase gene (tth111IIR, 3321 bp) (SEQ ID NO:21) and its encoded amino acid sequence (SEQ ID NO:22).

FIG. 3. Gene organization of Tth111II restriction-modification system.

FIG. 4. Recombinant Tth111II restriction endonuclease activity. Lane 1, 1 kb DNA marker; lanes 2 to 9, substrate DNA treated with diluted fractions from heparin sepharose column containing recombinant Tth111II restriction endonuclease-methylase fusion protein; The dilution factors in lanes 2 to 9 were: 4, 8, 16, 32, 64, 128, 256, 512. Lane 10: further dilution. Lane 11: substrate DNA digested with purified native Tth111II; Lane 12: substrate DNA=EcoRI linearized pBR322.

FIG. 5. Purified recombinant Tth111II restriction endonuclease-methylase fusion protein on SDS-PAG gel. Lane 1, broad range protein molecular weight marker, lane 2, purified Tth111II endonuclease-methylase fusion protein. Lane 3: purified native Tth111II with BSA.

DETAILED DESCRIPTION OF THE INVENTION

It was very difficult to purify sufficient Tth111II endonuclease from the native strain. Starting from 60 grams of cells and purification through heparin sepharose, Q HP, Heparin TSK and poly Cat A chromatography columns, Tth111II was purified to >95% purity. This procedure yielded less than 250 units of naive Tth111II. Cloning of Tth111II R coding sequence is a prerequisite for commercial production.

The cloning of tth111IIRM gene proved to be very difficult even though high-copy-number cloning vector such as pUCKm was used. Tth111II genomic DNA was partially digested with ApoI or NlaIII and DNA fragment between 3-10 kb was gel-purified and then ligated to EcoRI or SphI digested and CIP treated pUCkm. The ligated DNA was used to transform ER2502. Plasmid DNA was prepared from amplified transformants and challenged with Tth111II. Following Tth111II digestion, the DNA mixture was transformed back into E. coli ER2502 cells. Transformants were screened for resistance to Tth111II digestion. Out of 36 screened no true resistant clones were identified. More genomic DNA libraries were constructed. Genomic DNA was digested with Acc65I, AseI, AvrII, BfaI, BsiWI, BsrGI, MseI, NdeI, NheI, Nsil, NspI, PstI, SacI, SalI, SpeI, SphI, XbaI, and XhoI and ligated to cloning vector pUCKm with compatible ends. Following Tth111II digestion and retransformation, more clones were screened and no true Tth111II resistant clones were identified. These negative results suggested that the Tth111II challenge was not strong enough or the expression of Tth111II methylase gene was inadequate in E. coli to modify the Tth111II sites on the vector. It was concluded that the methylase selection method failed to clone the Tth111II methylase gene.

The purified Tth111II endonuclease protein was subjected to N-terminus protein sequencing. The N-terminus amino acid sequence was obtained. A pair of degenerated primers was designed based on the amino acid sequence. The first PCR attempt yielded a PCR product of 50-100 bp. Direct sequencing of the PCR product failed probably due to the primer degeneracy. After cloning and sequencing of the PCR products, it was confirmed that the amplified products were primer dimmer.

The method described herein by which the tth111IIRM gene is preferably cloned and expressed in E. coli using the following steps:

1. Purification of Native Tth111II from Thermus Thermophilus 111

Native Tth111II was purified from sixty grams of Thermus thermophilus 111 cell through four chromatographic columns: heparin sepharose, Q HP, heparin TSK, poly Cat A. After final step, the purity of Tth111II was >95%. It was a single band on the SDS-PAGE with the molecular weight of 115 kDa. .about.250 units were obtained from these cells. The yield of Tth111II was 4.2 units/gram of wet cells from the native strain.

2. PCR and Inverse PCR Amplification of tth111IIRM Gene

The N-terminus of Tth111II was sequenced and the sequence of the first twenty amino acids was derived. The amino acid sequence was used for degenerate PCR primer design in order to amplify the coding sequence. A set of PCR primers was designed including the GGATCC (BamHI site) for increased cloning efficiency. A PCR attempt was carried out to amplify the coding sequence. PCR product was obtained and digested with BamHI and then cloned into BamHI digested and CIP treated pUC19. Clones with the right size insert were sequenced. Some clones contained inserts in duplicate or triplicate. 16 independent sequences were obtained. The middle 14 base pairs coding sequence contained no ambiguity, which provided the sequence basis for making inverse PCR primers. Thermus thermophilus 111 genomic DNA was digested with restriction enzymes with 4 bp recognition sequences and then self-ligated. The self-ligated DNA was used as the templates for inverse PCR. PCR products were derived from AluI, BfaI, BstUI, MspI, NlaIII, and Sau3AI templates and sequenced. Additional three rounds of inverse PCR generated the entire coding sequence. The tth111IIRM gene is 3321 bp long, encoding an 1106 amino acid protein. The predicted molecular weight of this protein is 126 kDa, which is close agreement with the native Tth111II apparent molecular weight of 115 kDa. Conserved amino acid motif analysis revealed that this protein contained nine conserved motifs of gamma type aminomethyltransferase. Tth111II endonuclease protein is a fusion of endonuclease and methylase, which belongs to the restriction endonuclease type IIG (MmeI and Eco57I like enzymes). Further inverse PCR amplification of upstream sequence (640 bp) and downstream sequence (1 kb) did not reveal any open reading frame with homology to methylase. Thus, tth111IIR gene is a stand-alone endonuclease-methylase gene.

3. Expression of tth111IIR Gene in T7 Expression Vector pET28a

Two primers were used to amplify the tth111IIR gene in PCR. An XbaI-BamHI fragment containing the tth111IIR gene was cloned into pET28a expression vector. The ligated recombinant DNA was transformed into ER2744. The Km.sup.R transformants were induced with IPTG. Recombinant Tth111II activity was detected in the supernatant of the IPTG-induced cell extracts. Plasmids were extracted from those clones with high activity. It was found the pET28a with duplicate copy insert was the clone with highest activity and stability. After sequencing the insert, it was found the first copy insert contains the wild type sequence and the second copy insert contains a deletion of 6 bp. The second copy with two codon deletions may still encode an active methylase. This clone was used for the stability test and production of the Tth111II endonuclease protein.

4. Purification of Tth111II Endonuclease

Cell extract containing the recombinant Tth111II endonuclease-methylase fusion protein was purified by heat treatment and chromatography through Heparin Sepharose and DEAE Sepharose columns.

The present invention is further illustrated by the following Example. This Example is provided to aid in the understanding of the invention and is not construed as a limitation thereof.

The references cited above and below are herein incorporated by reference.

EXAMPLE I

Cloning of Tth111II Restriction-modification System (RM Fusion) in E. coli

1. Purification of the Native Tth111II

(a) 60 grams of wet Thermus thermophilus 111 cell was suspended in 3 times of column volume of starting buffer (20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 6 mM .beta.-mercaptoethanol, 1 mM EDTA, 5% glycerol), and was lysed by sonication.

(b) The cell extract was centrifuged. The first column is the 4 cm.times.10 cm Heparin Sepharose column. The column is eluted with a ten column volume NaCl gradient from 100 mM to 1 M. Fractions 56-60 containing Tth111II activity was collected. Pool was dialyzed against buffer (20 mM Tris-HCl, pH7.8, 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 5% glycerol).

(c) The pooled protein was purified through a 24 ml Q-HP column. Fractions 28-30 around 290 mM NaCl were pooled. Pool was dialyzed against buffer (20 mM Tris-HCl, pH7.8, 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 5% glycerol).

(d) Tth111II was purified through a 1.5 ml heparin TSK column. Fractions 51-53 around 600 mM NaCl were pooled. The pool volume is 60 ml.

(e) Dilute the above pool with 52 ml of the buffer (20 mM Kpi, pH 6.8, 1 mM DTT, 1 mM EDTA, 5% glycerol). The sample was loaded on a 5 ml poly cat A column. The proteins were eluted with a NaCl gradient. Fractions 44 and 45 were pooled, at .about.400 mM NaCl.

(f) A total of 250 units Tth111II were purified. The protein consists of a single band on the SDS-PAGE. The protein has an apparent molecular weight of 115 kDa. (FIG. 5) The enzyme was stored in 50% glycerol and 200 ug/ml BSA.

2. Sequencing the N-Terminus Region of Tth111II

The purified Tth111II protein was subjected to electrophoresis and electro-blotted to a membrane (Matsudaira, J. Biol. Chem, 262:10035-10038 (1987); Waite-Reese, et al., J. Bacteriology 173:5207-5219 (1991)). The membrane was then stained with Commassie blue R-250 and the 115-kDa protein band was excised and subjected to sequential degradation in an automated Precise 494 Protein/Peptide Sequence (Applied Biosystems, Foster City, Calif.).

The N-terminus of Tth111II was sequenced and following amino acid sequence was derived:

MSNWIDLYTHLKQEVPWFFN (SEQ ID NO:23)

3. Preparation of Genomic DNA and Restriction Digestion of Genomic DNA

Genomic DNA was prepared from Thermus thermophilus 111 (New England Biolabs' collection #249) by the standard procedure consisting of the following steps:

(a) Cell lysis by addition of lysozyme (2 mg/ml final), sucrose (1% final), and 50 mM Tris-HCl, pH 8.0;

(b) Cell lysis by addition of 10% SDS (final concentration 0.1%);

(c) Further cell lysis by addition of 1% Triton X-100 and 62 mM EDTA, 50 mM Tris-HCl, pH 8.0;

(d) Phenol-CHCl.sub.3 extraction of DNA 3 times (equal volume) and CHCl.sub.3 extraction once;

(e) DNA dialysis in 4 liters of TE buffer, change 3 times; and

(f) RNA removal by RNase A treatment and the genomic DNA was precipitated with 95% ethanol, washed with 70% ethanol, vacuum dried and resuspended in TE buffer.

4. PCR Amplification of N-terminus Coding Sequence

The following primers were synthesized from the N-terminal amino acid sequence:

5'-GGTGGTGGATCCAAYTGGATHGAYCTNTAYAC (284-368) (SEQ ID NO: 24) 5'-GGTGGTGGATCCRTTRAARAACCANGGNACYTCYTG (284-370) (SEQ ID NO: 25) (R = A, G; Y = C, T; N = A, G, C, T; H = A, C, T)

Gradient PCR was carried out under the following condition: 95.degree. C. 30 sec, 30-55.degree. C. (+0.7.degree. C. /cycle) 30 sec, 72.degree. C. 30 sec for 35 cycles with variation in MgSO.sub.4 concentration (2 mM to 10 mM) using Taq polymerase (New England Biolabs, Inc., Beverly, Mass.). PCR products were obtained in the reaction with 2, 4, 8 additional MgSO.sub.4. The PCR product was digested with BamHI overnight and ligated to pUC19 cut with BamHI and CIP treated. The ligated mix was then transformed into ER2502 competent cells. Eighteen plasmids were extracted and analyzed by BamHI digestion. Fifteen out of 18 contained inserts (1, 2, 3, 4, 5, 6, 7, 9, 10 11, 12, 13, 14, 17, 18) and the inserts were sequenced using pUC universal primers. The sequencing results showed that there is a segment of 14 bp sequences without any ambiguity (FIG. 1). The priming sites contain some degenerate nucleotide sequences that resulted from the degeneracy of the PCR primers.

5. Inverse PCR Cloning and Sequencing of the Adjacent DNA

Thermus thermophilus 111 genomic DNA was digested with restriction enzymes with 4 bp recognition sequence to identify DNA fragments that include part or all of the tth111IIR gene or the adjacent DNA sequences. The genomic DNA was digested with AluI, BfaI, BstUI, HaeIII, HhaI, HpyCH4IV, HpyCH4V, MseI, MspI, NlaIII, RsaI, Sau3AI, TaqI, and Tsp509I respectively at 37.degree. C. for 2 h. The restricted DNA was purified by Qiagen spin column and then used for self-ligation. Two .mu.g DNA was ligated in 500 .mu.l volume (2 .mu.g DNA, 50 .mu.l 10.times. ligation buffer, 2000 units T4 DNA ligase, sterile distilled water to 500 .mu.l, 16.degree. C. overnight). The ligated DNA was heat-treated at 65.degree. C. for 30 min to inactivate T4 DNA ligase and 20 .mu.l DNA was used as template for inverse PCR. The first pair of inverse PCR primers have the following sequences:

5'-ACCCATCTAAAACARGTNCCNTGGTT (286-192) (SEQ ID NO: 26) 5'-TGTTTTAGATGGGTRTANAGRTCDATCCA (286-244) (SEQ ID NO: 27) (R = A, G; N = A, G, C, T, D = A, G, T)

The inverse PCR conditions were one cycle of 95.degree. C. for 5 min, 95.degree. C. for 30 sec, 50.degree. C. for 1 min, 72.degree. C. for 1 min for 35 cycles, then 72.degree. C. for 7 min. The DNA polymerases were Taq DNA polymerase and Vent.RTM. (exo.sup.-) DNA polymerase. PCR products were found in the ligated templates of AluI: 350 bp, BfaI: >1500 bp, BstUI: 800 bp, HhaI: 200 bp, HpyCH4IV: >2000 bp, HpyCH4V: 200 bp, MspI: 450 bp, NlaIII: 250 bp, RsaI: 260 bp, Sau3AI: 500 bp, TaqI: 400 bp, Tsp509I: 150 bp. The PCR products were gel-purified and sequenced which generated approximately 2000 bp sequence.

The second round of inverse PCR used the following primers:

5'-ACCGGACTCTACGAGAGGTTGCGC (286-320) (SEQ ID NO: 28) 5'-GTCGGCATGGAGGGCATCGGCCAG (286-321) (SEQ ID NO: 29)

The genomic DNA of Thermus thermophilus 111 was digested by ApoI, BsrFI, MseI, NgoMIV, RsaI, SmaI, StuI, and Tsp509I, respectively, at 37.degree. C. for 2 h. The restricted DNA was purified by Qiagen spin column and then used for self-ligation. Two .mu.g DNA was ligated in 500 .mu.l volume (2 .mu.g DNA, 50 .mu.l 10.times. ligation buffer, 2000 units T4 DNA ligase, sterile distilled water to 500 .mu.l, 16.degree. C. overnight). The ligated DNA was heat-treated at 65.degree. C. for 30 min to inactivate T4 DNA ligase and 20 .mu.l DNA was used as template for inverse PCR. Inverse PCR condition was 95.degree. C. for 5 min for 1 cycle, 95.degree. C. for 1 min, 55.degree. C. for 1 min, 72.degree. C. for 2 min for 35 cycles. PCR products were found in the self-ligated templates of ApoI: 800 bp, BsrFI: 750 bp, MseI: 1200 bp, NgoMIV: 750 bp, RsaI: 800 bp, SmaI: 800 bp, StuI: 700 bp, Tsp509I: 800 bp. PCR product from MseI template was gel-purified and sequenced that produced 1010 bp new sequence.

The third round of inverse PCR used the following primers:

5'-GGACAGGAACGGACCGCATGGTGG (287-040) (SEQ ID NO: 30) 5'-TAGCGCCTGAAGCCGGAACGCTCC (287-041) (SEQ ID NO: 31)

The genomic DNA from Thermus thermophilus 111 was digested by AluI, ApoI, MfeI, MscI, NspI, PvuII, and SphI, respectively, at 37.degree. C. for 2 h. The restricted DNA was purified by Qiagen spin column and then used for self-ligation. Two .mu.g DNA was ligated in 500 .mu.l volume (2 .mu.g DNA, 50 .mu.l 10.times. ligation buffer, 2000 units T4 DNA ligase, sterile distilled water to 500 .mu.l, 16.degree. C. overnight). The ligated DNA was heat-treated at 65.degree. C. for 30 min to inactivate T4 DNA ligase and 20 .mu.l DNA was used as template for inverse PCR. Inverse PCR condition was 95.degree. C. 5 min for 1 cycle, 95.degree. C. for 1 min, 55.degree. C. for 1 min, 72.degree. C. for 2 min for 35 cycles. PCR products were found in the templates of AfeI: 1.8 kb, AluI: 1.1 kb, HpyCH4V 400 bp, NgoMIV: 2.8 kb, SmaI: 1.5 kb, Tsp509I: 1.6 kb. The PCR product from the AfeI template was sequenced generated .about.1.7 kb new sequence.

After the third round of inverse PCR, the entire tth111IIR gene was obtained. The gene is 3321 bp in length, encoding a protein of 1106 amino acids. The predicted molecular mass of Tth111II is 126 kDa (FIG. 2). The Tth111II endonuclease is a fusion of an endonuclease domain and an amino-methylase domain. Therefore, Tth111II endonuclease gene can be referred to as tth111IIR or tth111IIRM gene.

There is no second methylase gene adjacent to Tth111IIRM gene upstream or downstream. The tth111IIRM gene is a stand-alone gene (FIG. 3). The upstream sequence has homology to a galactose binding lectin encoding gene. The downstream sequence has a low homology to cuticle collagen encoding gene.

6. Expression of tth111IIRM Gene in T7 Expression Vector pET28a

XbaI restriction site (5'TCTAGA3') was incorporated in the forward PCR primer, BamHI restriction site (5'GGATCC3') was incorporated into the reverse PCR primers for amplification of Tth111IIRM gene by PCR. The primers have the following sequences:

5' GGTGGTTCTAGAAATAATTTTGTTTAACTTTAAGGAGGTAAATAGAA (287-354) (SEQ ID NO: 32) CTGGATCGATCTTTACACCCAT 3' 5' GGTGGTGGATCCCTACCCCCGCAACTCCTCCAAACT 3' (287-355). (SEQ ID NO: 33)

The tth111IIRM gene was amplified by PCR using Deep Vent DNA polymerase and primers 287-354 and 287-355 under conditions of 95.degree. C. for 1 min, 65.degree. C. for 1 min, 72.degree. C. for 3.5 min for 25 cycles. The PCR product was purified by Qiagen spin column and digested overnight with XbaI and BamHI. After DNA purification from low-melting agarose gel, the PCR DNA was ligated to CIP-treated pET28a with compatible ends. The ligated DNA was transformed into E. coli host ER2744 and selected for Km.RTM. transformants. Individual transformants were then picked and cultured in 10 ml LB plus Km (50 .mu.g/ml) and induced with IPTG (0.5 mM final) for 3 h. Cell extracts of six clones were tested for Tth111II activity. All were active and two clones (#1 and #2) displayed higher activity. Plasmid digested by XbaI and BamHI showed that #1 and #2 contained tth111IIRM gene duplication. The rest of clones (#3, #4, #5, #6) contained a single-copy gene. The duplicated insert contained one copy of the wt sequence and one copy of mutant gene with two-codon deletion. The mutant copy deleted the first 6 bp (including the start codon). The gene duplication generated the following sequence:

5' GGGGGTAG------GTGGATCGATCTTT (SEQ ID NO: 34)

The underlined nucleotide is the end of the first copy and the italicized sequence is the beginning of the mutant copy. Clones with this type of gene duplication were more stable and produced higher Tth111II endonuclease activity in cell extract. It was more stable probably due to the deletion mutant gene may still encode a functional methylase but inactive in endonuclease activity. This clone was used in subsequent large-scale purification of Tth111II endonuclease protein.

It was noted that Tth111II recognizes the double-stranded DNA sequence 5'CAARCA3'N11/N9. Only the top DNA strand 5'CAARCA3' contains target base methylation site. The bottom strand 5'TGYTTG3' does not contain any known methylation site. It is not known how the native strain or the E. coli expression host deals with unmodified Tth111II site following DNA replication.

7. Purification of Tth111II Endonuclease

Cell extract was prepared by sonication of 4 grams of cells resuspended in 20 ml sonication buffer (50 mM Tris-HCl, pH 7.8, 10 mM .beta.-mercaptoethanol). Cell debris was removed by centrifugation. The cell extract was heated at 65.degree. C. for one hour to denature E. coli thermolabile proteins. Denatured proteins were removed by centrifugation. The supernatant was loaded onto a 20 ml Heparin Sepharose column. Following extensive washing with low salt buffer (20 mM Tris-HCl, pH 7.5, 50 mM NaCl, 10 mM .beta.-mercaptoethanol, 0.1 mM EDTA), proteins were eluted with a NaCl gradient of 0.05 M-1 M. Fractions containing Tth111II endonuclease as determined by an activity assay were pooled and dialyzed overnight in DEAE-Sepharose loading buffer (20 mM Tris-HCl, pH 7.5, 50 mM NaCl, 10 mM .beta.-mercaptoethanol, 0.1 mM EDTA). After dialysis, the protein mixture was loaded onto a DEAE Sepharose column equilibrated with the same buffer. Proteins were eluted with a 0.05 M-1 M NaCl gradient and those fractions containing purified Tth111II were pooled. The purified recombinant Tth111II was homogeneous in SDS-PAGE gel (>95% purity, FIG. 5). A total of 20,000 units of purified Tth111II endonuclease were obtained from 4 g of IPTG-induced cells.

The strain ER2744 [pET28a-Tth111IIRM] has been deposited under the terms and conditions of the Budapest Treaty with the American Type Culture Collection on Jan. 8, 2003 and received ATCC Accession No. PTA 4891.

SEQUENCE LISTING <100> GENERAL INFORMATION: <160> NUMBER OF SEQ ID NOS: 34 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 1 <211> LENGTH: 5 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: primer <400> SEQUENCE: 1 ccwgg 5 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 2 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: Nocardia otitidis-caviarum <400> SEQUENCE: 2 gcggccgc 8 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 3 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 3 aactggattg acctgtacac ccatctaaaa caggaggtcc cctggttctt caac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 4 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 4 aactggattg atctgtatac ccatctaaaa caagaagttc cctggttctt caac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 5 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 5 aactggattg atctgtatac ccatctaaaa caggaagttc cgtggttttt caac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 6 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 6 aactggatag atctgtacac ccatctaaaa caagaagtcc cctggttctt caac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 7 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 7 aactggatag atctgtacac ccatctaaaa caagaggtcc cttggttctt caac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 8 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 8 aactggatcg atctctacac ccatctaaaa caagaagtcc cctggttttt caat 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 9 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 9 aactggatag atctctacac ccatctaaaa caggaggtcc cgtggttctt caac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 10 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 10 aattggatag acctgtacac ccatctaaaa caagaggttc cttggttctt taac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 11 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 11 aattggatag acctgtacac ccatctaaaa caggaggtcc cctggttctt taat 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 12 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 12 aattggatag acctatacac ccatctaaaa caggaagtgc cctggttttt caat 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 13 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 13 aattggatcg acctgtacac ccatctaaaa caggaggtcc cgtggttttt caac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 14 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 14 aattggatag atctctacac ccatctaaaa caggaggtcc cttggttctt caac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 15 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 15 aattggatag acctgtacac ccatctaaaa caagaggtcc cctggttctt taac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 16 <211> LENGTH: 55 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: Sequence isolate <400> SEQUENCE: 16 aattggatag atctgtatac ccatctaasa acaggaagtc ccttggtttt tcaac 55 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 17 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 17 aattggatag acctctacac ccatctaaaa caggaggtcc cttggttctt caac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 18 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: sequence isolate <400> SEQUENCE: 18 aattggatcg atctgtacac ccatctaaaa caagaagtcc cctggttctt taac 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 19 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: consensus sequence <400> SEQUENCE: 19 aaytggatng ayctntayac ccatctaaaa cargargtnc cntggttytt yaay 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 20 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: coding sequence of the tth111IIR gene <400> SEQUENCE: 20 aactggatcg atctttacac ccatctaaaa caagaggtcc cttggttttt taat 54 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 21 <211> LENGTH: 3321 <212> TYPE: DNA <213> ORGANISM: thermus thermophilus 111 <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(3321) <223> OTHER INFORMATION: <400> SEQUENCE: 21 atg aac tgg atc gat ctt tac acc cat cta aaa caa gag gtc cct tgg 48 Met Asn Trp Ile Asp Leu Tyr Thr His Leu Lys Gln Glu Val Pro Trp 1 5 10 15 ttt ttt aat tcc gtc cgt ctc gca gcc agc caa gcc cat aac gag gcc 96 Phe Phe Asn Ser Val Arg Leu Ala Ala Ser Gln Ala His Asn Glu Ala 20 25 30 gag ttt gag agt cgg ata aac aat gca att gag cgc ttg gct cag aag 144 Glu Phe Glu Ser Arg Ile Asn Asn Ala Ile Glu Arg Leu Ala Gln Lys 35 40 45 ttg ggt gtt cag ctg ctt ttc cgg gaa caa tat acg ctg gcc act ggc 192 Leu Gly Val Gln Leu Leu Phe Arg Glu Gln Tyr Thr Leu Ala Thr Gly 50 55 60 cgc gct gat gct gtg tac aac cgt ctg gtg ata gaa tac gag cca ccc 240 Arg Ala Asp Ala Val Tyr Asn Arg Leu Val Ile Glu Tyr Glu Pro Pro 65 70 75 80 ggt tct ttg cgg cca aat ttg aaa cac agc cac act cag cat gcg gtg 288 Gly Ser Leu Arg Pro Asn Leu Lys His Ser His Thr Gln His Ala Val 85 90 95 cgg cag gtc atg aac tac att gag gag tta tcc aga gcg gaa agg cat 336 Arg Gln Val Met Asn Tyr Ile Glu Glu Leu Ser Arg Ala Glu Arg His 100 105 110 gac cgc gac cgc ctg ctg ggg gtc gtc ttc gac ggc cac tac ttc atc 384 Asp Arg Asp Arg Leu Leu Gly Val Val Phe Asp Gly His Tyr Phe Ile 115 120 125 ttt gtc cgc tac cat gag ggg cac tgg atc gta gaa gag ccc ctg gag 432 Phe Val Arg Tyr His Glu Gly His Trp Ile Val Glu Glu Pro Leu Glu 130 135 140 gtg aat ccg gcg tcg tgt gag cgc ttc ctg cgt tct ctc ttc tcc ctt 480 Val Asn Pro Ala Ser Cys Glu Arg Phe Leu Arg Ser Leu Phe Ser Leu 145 150 155 160 tct tcg ggc cgg gcg ctg att ccc gag aac ctg gtg gag gac ttc ggg 528 Ser Ser Gly Arg Ala Leu Ile Pro Glu Asn Leu Val Glu Asp Phe Gly 165 170 175 agc cag aac gac ctc agc cgc cag gcc acc cgt gcc ctc tac cac gcg 576 Ser Gln Asn Asp Leu Ser Arg Gln Ala Thr Arg Ala Leu Tyr His Ala 180 185 190 ctg cag ggt cat acc agt gat ctg acc gcc cgc ctc ttt gtc cag tgg 624 Leu Gln Gly His Thr Ser Asp Leu Thr Ala Arg Leu Phe Val Gln Trp 195 200 205 caa atc ttc ttc ggc gag acg gcc ggt gcc gat gct gcg gga ggc gaa 672 Gln Ile Phe Phe Gly Glu Thr Ala Gly Ala Asp Ala Ala Gly Gly Glu 210 215 220 cta aag cac aag agt gaa ctg ctt gcc ttt gcc cgc ggc atg ggg ctg 720 Leu Lys His Lys Ser Glu Leu Leu Ala Phe Ala Arg Gly Met Gly Leu 225 230 235 240 cgg ggc agc cgg ata gac atg ccc cgc ttc ctc ttt gcc ctg cac acg 768 Arg Gly Ser Arg Ile Asp Met Pro Arg Phe Leu Phe Ala Leu His Thr 245 250 255 tac ttc tcc ttc ctg gtc aaa aac atc gcc cgc ctg gtg ctc cag gcc 816 Tyr Phe Ser Phe Leu Val Lys Asn Ile Ala Arg Leu Val Leu Gln Ala 260 265 270 tat gcg ggt ggc ggg ctg ggc acc acg ccc cta acc acc atc gcc aac 864 Tyr Ala Gly Gly Gly Leu Gly Thr Thr Pro Leu Thr Thr Ile Ala Asn 275 280 285 ctg gaa ggc gag gcc ctg cgc cgg gaa ctg caa aac ctg gaa agc ggc 912 Leu Glu Gly Glu Ala Leu Arg Arg Glu Leu Gln Asn Leu Glu Ser Gly 290 295 300 gga ctt ttc cgt acc ctg ggc cta aag aac ctg ctg gag ggt gac ttc 960

Gly Leu Phe Arg Thr Leu Gly Leu Lys Asn Leu Leu Glu Gly Asp Phe 305 310 315 320 ttc gcc tgg tac ctg gac gcc tgg aac ccg gaa gtg gaa gaa gcc ctg 1008 Phe Ala Trp Tyr Leu Asp Ala Trp Asn Pro Glu Val Glu Glu Ala Leu 325 330 335 cgc cag gtg ctg gcc cgc ctg gcc gag tac aac ccg gcc acc gtg cag 1056 Arg Gln Val Leu Ala Arg Leu Ala Glu Tyr Asn Pro Ala Thr Val Gln 340 345 350 gac gac ccc cac agc gcc cgc gac ctg ctg aaa aag ctc tac cac tac 1104 Asp Asp Pro His Ser Ala Arg Asp Leu Leu Lys Lys Leu Tyr His Tyr 355 360 365 ctc ctg ccg cgg gac atc cgc cac gac ctg ggc gag ttc tac acc ccc 1152 Leu Leu Pro Arg Asp Ile Arg His Asp Leu Gly Glu Phe Tyr Thr Pro 370 375 380 gac tgg ctg gcc gag cgt ctg ctc aac cag ctg ggt gaa ccc tgg ttc 1200 Asp Trp Leu Ala Glu Arg Leu Leu Asn Gln Leu Gly Glu Pro Trp Phe 385 390 395 400 atc atg ccc ccg ggg aac cac ccg ccc agg ggc ttg ccc gac aag cgc 1248 Ile Met Pro Pro Gly Asn His Pro Pro Arg Gly Leu Pro Asp Lys Arg 405 410 415 ctg ctg gac ccg gcc tgc ggc tcc ggc acc ttc ccg gtg ctg gcc atc 1296 Leu Leu Asp Pro Ala Cys Gly Ser Gly Thr Phe Pro Val Leu Ala Ile 420 425 430 cgc gcc ctc aag gtc aac tgc ttc ctg gct ggc ttc tcc gag gct gac 1344 Arg Ala Leu Lys Val Asn Cys Phe Leu Ala Gly Phe Ser Glu Ala Asp 435 440 445 acc ctg gag gtt atc ctg aac agc gtg gtg ggc att gac ctc aac ccc 1392 Thr Leu Glu Val Ile Leu Asn Ser Val Val Gly Ile Asp Leu Asn Pro 450 455 460 ttg gct gtg acc gca gcc cgg gtc aac tac ctg ctg gcc atc gcc gac 1440 Leu Ala Val Thr Ala Ala Arg Val Asn Tyr Leu Leu Ala Ile Ala Asp 465 470 475 480 ctg ctc cct tac cgc cgc cgg gag gtg gaa att ccg gtc tat ctc gcc 1488 Leu Leu Pro Tyr Arg Arg Arg Glu Val Glu Ile Pro Val Tyr Leu Ala 485 490 495 gac agc ata ctt acg ccg gcc cgc ggg gaa ggg ctc ttc gcc cag aac 1536 Asp Ser Ile Leu Thr Pro Ala Arg Gly Glu Gly Leu Phe Ala Gln Asn 500 505 510 cgc cgc atc ctg gag acc gcg gtc ggc ccc ctg ccc gtg ccc gag gtg 1584 Arg Arg Ile Leu Glu Thr Ala Val Gly Pro Leu Pro Val Pro Glu Val 515 520 525 att aac agc cgc gct aag atg gaa cgg ctc acc gac ctg ctt gaa gag 1632 Ile Asn Ser Arg Ala Lys Met Glu Arg Leu Thr Asp Leu Leu Glu Glu 530 535 540 tac gtc cgc ggg gat ttc tcc acc gag gcc ttc ctt gcc cgg gcc aaa 1680 Tyr Val Arg Gly Asp Phe Ser Thr Glu Ala Phe Leu Ala Arg Ala Lys 545 550 555 560 aag gaa atc ccc gac ctg gcc gat gcc ctc cat gcc gac gaa gtg atc 1728 Lys Glu Ile Pro Asp Leu Ala Asp Ala Leu His Ala Asp Glu Val Ile 565 570 575 acc gga ctc tac gag agg ttg cgc gac ctc cac cgc cag ggg cta gat 1776 Thr Gly Leu Tyr Glu Arg Leu Arg Asp Leu His Arg Gln Gly Leu Asp 580 585 590 ggc atc tgg gcc cgg gtg ctc aag aac gct ttc atg ccc ctc ttc ctg 1824 Gly Ile Trp Ala Arg Val Leu Lys Asn Ala Phe Met Pro Leu Phe Leu 595 600 605 gaa ccc ttt gac tac gtg gtg ggc aat ccg ccc tgg atc aac tgg gaa 1872 Glu Pro Phe Asp Tyr Val Val Gly Asn Pro Pro Trp Ile Asn Trp Glu 610 615 620 agc ttg ccc cag gcc tac cgg gag caa acg gcc gag tta tgg aca tgy 1920 Ser Leu Pro Gln Ala Tyr Arg Glu Gln Thr Ala Glu Leu Trp Thr Cys 625 630 635 640 tac ggc ctc ttc gtc cat tcc ggc atg gat acc atc ctg ggc aag ggc 1968 Tyr Gly Leu Phe Val His Ser Gly Met Asp Thr Ile Leu Gly Lys Gly 645 650 655 aaa aag gac gcc tcc acc ctg atg acc tac gcc gtg gcc gac cgc ttc 2016 Lys Lys Asp Ala Ser Thr Leu Met Thr Tyr Ala Val Ala Asp Arg Phe 660 665 670 ttg aaa gag ggc ggc aaa ctg ggc ttc ctc atc acc cag agc gtc tgg 2064 Leu Lys Glu Gly Gly Lys Leu Gly Phe Leu Ile Thr Gln Ser Val Trp 675 680 685 aaa act ggg gct ggg cag ggc ttc cgc cgt ttc cgt atc gga gaa aac 2112 Lys Thr Gly Ala Gly Gln Gly Phe Arg Arg Phe Arg Ile Gly Glu Asn 690 695 700 ggc ccc cat ttg cgc gtg cta cac gtg gac gac ctc tcc agc ctg caa 2160 Gly Pro His Leu Arg Val Leu His Val Asp Asp Leu Ser Ser Leu Gln 705 710 715 720 gtc ttt gaa gga gcc agc aca cgc acc agc gcc ttc gtc ctg cag aag 2208 Val Phe Glu Gly Ala Ser Thr Arg Thr Ser Ala Phe Val Leu Gln Lys 725 730 735 ggc cgg ccc ccc cgc tac ccg gtg ccc tac act tac tgg aag aag acg 2256 Gly Arg Pro Pro Arg Tyr Pro Val Pro Tyr Thr Tyr Trp Lys Lys Thr 740 745 750 acc aaa ggc gag ggg ctg gac tac gac agc acc ctg ggc gag gtg atg 2304 Thr Lys Gly Glu Gly Leu Asp Tyr Asp Ser Thr Leu Gly Glu Val Met 755 760 765 gaa cag acc aaa cgt ctt cgg ttc cac gcc gtg ccg gtg gac ccg gac 2352 Glu Gln Thr Lys Arg Leu Arg Phe His Ala Val Pro Val Asp Pro Asp 770 775 780 gac ctc acc agc ccc tgg ctc acc gcc cgc cgc agg gcc ctg tac tcc 2400 Asp Leu Thr Ser Pro Trp Leu Thr Ala Arg Arg Arg Ala Leu Tyr Ser 785 790 795 800 gtg cgc aag gtg ctg ggg acg tcg gag tac cgg gcg tac gaa gga gcc 2448 Val Arg Lys Val Leu Gly Thr Ser Glu Tyr Arg Ala Tyr Glu Gly Ala 805 810 815 aac agt gga gga gcc aac ggc atc tac tgg ctg gaa atc ctg gcc gag 2496 Asn Ser Gly Gly Ala Asn Gly Ile Tyr Trp Leu Glu Ile Leu Ala Glu 820 825 830 cga ccg gac ggg ctg gtg gtg gtg cgc aat gtg act gag ggg gct aaa 2544 Arg Pro Asp Gly Leu Val Val Val Arg Asn Val Thr Glu Gly Ala Lys 835 840 845 cgg gag gtg gag ggc att acc acc gaa ctg gag ccc gac ctg ctc tac 2592 Arg Glu Val Glu Gly Ile Thr Thr Glu Leu Glu Pro Asp Leu Leu Tyr 850 855 860 ccc ctg ctg cgc ggc cgg gat gtg cgc cgc tgg tat gca caa cca tct 2640 Pro Leu Leu Arg Gly Arg Asp Val Arg Arg Trp Tyr Ala Gln Pro Ser 865 870 875 880 ttg cac atc ctc atg gtg cag gac ccc aag acg cgg cgg ggc ata gac 2688 Leu His Ile Leu Met Val Gln Asp Pro Lys Thr Arg Arg Gly Ile Asp 885 890 895 gag cag gtg ctc cag aag cgc tac ccc aag acc tgg gcc tac ctc aag 2736 Glu Gln Val Leu Gln Lys Arg Tyr Pro Lys Thr Trp Ala Tyr Leu Lys 900 905 910 cgc ttt gag gcg gtg ctg cgg gag cgt tcc ggc ttc agg cgc tac ttt 2784 Arg Phe Glu Ala Val Leu Arg Glu Arg Ser Gly Phe Arg Arg Tyr Phe 915 920 925 acc cgc aag gac agg aac ggc cgc atg gtg gaa acc ggc ccc ttc tac 2832 Thr Arg Lys Asp Arg Asn Gly Arg Met Val Glu Thr Gly Pro Phe Tyr 930 935 940 tct atg ttt aac gtc ggc gac tac acc ttc gcg ccg tgg aag gtg gtg 2880 Ser Met Phe Asn Val Gly Asp Tyr Thr Phe Ala Pro Trp Lys Val Val 945 950 955 960 tgg cga tac gtg gct tcg gat ttt att gtt gct gta gta ggt cct gct 2928 Trp Arg Tyr Val Ala Ser Asp Phe Ile Val Ala Val Val Gly Pro Ala 965 970 975 tca gat gag aag ccc gtt gtt cct aac gaa aag ctt atg tta gtg cct 2976 Ser Asp Glu Lys Pro Val Val Pro Asn Glu Lys Leu Met Leu Val Pro 980 985 990 gtt gaa gac gat aat gag gct ttc tac ttg tgt ggg gtt ctg aac tct 3024 Val Glu Asp Asp Asn Glu Ala Phe Tyr Leu Cys Gly Val Leu Asn Ser 995 1000 1005 tct cca atc cgt ttt gcg gtc caa agt ttc ttt gtc caa aca caa 3069 Ser Pro Ile Arg Phe Ala Val Gln Ser Phe Phe Val Gln Thr Gln 1010 1015 1020 att gcc cct cac gtg ctt caa aaa ctt tgc att ccc aga tat gaa 3114 Ile Ala Pro His Val Leu Gln Lys Leu Cys Ile Pro Arg Tyr Glu 1025 1030 1035 ccg aac act gac cat caa aat cgc atc gcc cac ctc tcc cgc cgc 3159 Pro Asn Thr Asp His Gln Asn Arg Ile Ala His Leu Ser Arg Arg 1040 1045 1050 gcc cac gag ctg gcc ccg gcg gcc tac aat ggg gac aaa gcg gcc 3204 Ala His Glu Leu Ala Pro Ala Ala Tyr Asn Gly Asp Lys Ala Ala 1055 1060 1065 cgg gcc gaa ctg cgg cgg gtg gaa gag gag att gac cgg gcc gcg 3249 Arg Ala Glu Leu Arg Arg Val Glu Glu Glu Ile Asp Arg Ala Ala 1070 1075 1080 gcc caa ctc tgg ggc ctg acg gag gag gaa ctg gcc gag att cgg 3294 Ala Gln Leu Trp Gly Leu Thr Glu Glu Glu Leu Ala Glu Ile Arg 1085 1090 1095 cgg agt ttg gag gag ttg cgg ggg tag 3321 Arg Ser Leu Glu Glu Leu Arg Gly 1100 1105 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 22 <211> LENGTH: 1106 <212> TYPE: PRT <213> ORGANISM: thermus thermophilus 111 <400> SEQUENCE: 22 Met Asn Trp Ile Asp Leu Tyr Thr His Leu Lys Gln Glu Val Pro Trp 1 5 10 15 Phe Phe Asn Ser Val Arg Leu Ala Ala Ser Gln Ala His Asn Glu Ala 20 25 30 Glu Phe Glu Ser Arg Ile Asn Asn Ala Ile Glu Arg Leu Ala Gln Lys 35 40 45 Leu Gly Val Gln Leu Leu Phe Arg Glu Gln Tyr Thr Leu Ala Thr Gly 50 55 60 Arg Ala Asp Ala Val Tyr Asn Arg Leu Val Ile Glu Tyr Glu Pro Pro 65 70 75 80 Gly Ser Leu Arg Pro Asn Leu Lys His Ser His Thr Gln His Ala Val 85 90 95 Arg Gln Val Met Asn Tyr Ile Glu Glu Leu Ser Arg Ala Glu Arg His 100 105 110 Asp Arg Asp Arg Leu Leu Gly Val Val Phe Asp Gly His Tyr Phe Ile 115 120 125 Phe Val Arg Tyr His Glu Gly His Trp Ile Val Glu Glu Pro Leu Glu 130 135 140 Val Asn Pro Ala Ser Cys Glu Arg Phe Leu Arg Ser Leu Phe Ser Leu 145 150 155 160 Ser Ser Gly Arg Ala Leu Ile Pro Glu Asn Leu Val Glu Asp Phe Gly 165 170 175 Ser Gln Asn Asp Leu Ser Arg Gln Ala Thr Arg Ala Leu Tyr His Ala 180 185 190 Leu Gln Gly His Thr Ser Asp Leu Thr Ala Arg Leu Phe Val Gln Trp 195 200 205 Gln Ile Phe Phe Gly Glu Thr Ala Gly Ala Asp Ala Ala Gly Gly Glu 210 215 220 Leu Lys His Lys Ser Glu Leu Leu Ala Phe Ala Arg Gly Met Gly Leu 225 230 235 240 Arg Gly Ser Arg Ile Asp Met Pro Arg Phe Leu Phe Ala Leu His Thr 245 250 255 Tyr Phe Ser Phe Leu Val Lys Asn Ile Ala Arg Leu Val Leu Gln Ala 260 265 270 Tyr Ala Gly Gly Gly Leu Gly Thr Thr Pro Leu Thr Thr Ile Ala Asn 275 280 285 Leu Glu Gly Glu Ala Leu Arg Arg Glu Leu Gln Asn Leu Glu Ser Gly 290 295 300 Gly Leu Phe Arg Thr Leu Gly Leu Lys Asn Leu Leu Glu Gly Asp Phe 305 310 315 320 Phe Ala Trp Tyr Leu Asp Ala Trp Asn Pro Glu Val Glu Glu Ala Leu 325 330 335 Arg Gln Val Leu Ala Arg Leu Ala Glu Tyr Asn Pro Ala Thr Val Gln 340 345 350 Asp Asp Pro His Ser Ala Arg Asp Leu Leu Lys Lys Leu Tyr His Tyr 355 360 365 Leu Leu Pro Arg Asp Ile Arg His Asp Leu Gly Glu Phe Tyr Thr Pro 370 375 380 Asp Trp Leu Ala Glu Arg Leu Leu Asn Gln Leu Gly Glu Pro Trp Phe 385 390 395 400 Ile Met Pro Pro Gly Asn His Pro Pro Arg Gly Leu Pro Asp Lys Arg 405 410 415 Leu Leu Asp Pro Ala Cys Gly Ser Gly Thr Phe Pro Val Leu Ala Ile 420 425 430 Arg Ala Leu Lys Val Asn Cys Phe Leu Ala Gly Phe Ser Glu Ala Asp 435 440 445 Thr Leu Glu Val Ile Leu Asn Ser Val Val Gly Ile Asp Leu Asn Pro 450 455 460 Leu Ala Val Thr Ala Ala Arg Val Asn Tyr Leu Leu Ala Ile Ala Asp 465 470 475 480 Leu Leu Pro Tyr Arg Arg Arg Glu Val Glu Ile Pro Val Tyr Leu Ala 485 490 495 Asp Ser Ile Leu Thr Pro Ala Arg Gly Glu Gly Leu Phe Ala Gln Asn 500 505 510 Arg Arg Ile Leu Glu Thr Ala Val Gly Pro Leu Pro Val Pro Glu Val 515 520 525 Ile Asn Ser Arg Ala Lys Met Glu Arg Leu Thr Asp Leu Leu Glu Glu 530 535 540 Tyr Val Arg Gly Asp Phe Ser Thr Glu Ala Phe Leu Ala Arg Ala Lys 545 550 555 560 Lys Glu Ile Pro Asp Leu Ala Asp Ala Leu His Ala Asp Glu Val Ile 565 570 575 Thr Gly Leu Tyr Glu Arg Leu Arg Asp Leu His Arg Gln Gly Leu Asp 580 585 590 Gly Ile Trp Ala Arg Val Leu Lys Asn Ala Phe Met Pro Leu Phe Leu 595 600 605 Glu Pro Phe Asp Tyr Val Val Gly Asn Pro Pro Trp Ile Asn Trp Glu 610 615 620 Ser Leu Pro Gln Ala Tyr Arg Glu Gln Thr Ala Glu Leu Trp Thr Cys 625 630 635 640 Tyr Gly Leu Phe Val His Ser Gly Met Asp Thr Ile Leu Gly Lys Gly 645 650 655 Lys Lys Asp Ala Ser Thr Leu Met Thr Tyr Ala Val Ala Asp Arg Phe 660 665 670 Leu Lys Glu Gly Gly Lys Leu Gly Phe Leu Ile Thr Gln Ser Val Trp 675 680 685 Lys Thr Gly Ala Gly Gln Gly Phe Arg Arg Phe Arg Ile Gly Glu Asn 690 695 700 Gly Pro His Leu Arg Val Leu His Val Asp Asp Leu Ser Ser Leu Gln 705 710 715 720 Val Phe Glu Gly Ala Ser Thr Arg Thr Ser Ala Phe Val Leu Gln Lys 725 730 735 Gly Arg Pro Pro Arg Tyr Pro Val Pro Tyr Thr Tyr Trp Lys Lys Thr

740 745 750 Thr Lys Gly Glu Gly Leu Asp Tyr Asp Ser Thr Leu Gly Glu Val Met 755 760 765 Glu Gln Thr Lys Arg Leu Arg Phe His Ala Val Pro Val Asp Pro Asp 770 775 780 Asp Leu Thr Ser Pro Trp Leu Thr Ala Arg Arg Arg Ala Leu Tyr Ser 785 790 795 800 Val Arg Lys Val Leu Gly Thr Ser Glu Tyr Arg Ala Tyr Glu Gly Ala 805 810 815 Asn Ser Gly Gly Ala Asn Gly Ile Tyr Trp Leu Glu Ile Leu Ala Glu 820 825 830 Arg Pro Asp Gly Leu Val Val Val Arg Asn Val Thr Glu Gly Ala Lys 835 840 845 Arg Glu Val Glu Gly Ile Thr Thr Glu Leu Glu Pro Asp Leu Leu Tyr 850 855 860 Pro Leu Leu Arg Gly Arg Asp Val Arg Arg Trp Tyr Ala Gln Pro Ser 865 870 875 880 Leu His Ile Leu Met Val Gln Asp Pro Lys Thr Arg Arg Gly Ile Asp 885 890 895 Glu Gln Val Leu Gln Lys Arg Tyr Pro Lys Thr Trp Ala Tyr Leu Lys 900 905 910 Arg Phe Glu Ala Val Leu Arg Glu Arg Ser Gly Phe Arg Arg Tyr Phe 915 920 925 Thr Arg Lys Asp Arg Asn Gly Arg Met Val Glu Thr Gly Pro Phe Tyr 930 935 940 Ser Met Phe Asn Val Gly Asp Tyr Thr Phe Ala Pro Trp Lys Val Val 945 950 955 960 Trp Arg Tyr Val Ala Ser Asp Phe Ile Val Ala Val Val Gly Pro Ala 965 970 975 Ser Asp Glu Lys Pro Val Val Pro Asn Glu Lys Leu Met Leu Val Pro 980 985 990 Val Glu Asp Asp Asn Glu Ala Phe Tyr Leu Cys Gly Val Leu Asn Ser 995 1000 1005 Ser Pro Ile Arg Phe Ala Val Gln Ser Phe Phe Val Gln Thr Gln 1010 1015 1020 Ile Ala Pro His Val Leu Gln Lys Leu Cys Ile Pro Arg Tyr Glu 1025 1030 1035 Pro Asn Thr Asp His Gln Asn Arg Ile Ala His Leu Ser Arg Arg 1040 1045 1050 Ala His Glu Leu Ala Pro Ala Ala Tyr Asn Gly Asp Lys Ala Ala 1055 1060 1065 Arg Ala Glu Leu Arg Arg Val Glu Glu Glu Ile Asp Arg Ala Ala 1070 1075 1080 Ala Gln Leu Trp Gly Leu Thr Glu Glu Glu Leu Ala Glu Ile Arg 1085 1090 1095 Arg Ser Leu Glu Glu Leu Arg Gly 1100 1105 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 23 <211> LENGTH: 20 <212> TYPE: PRT <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: amino acid derived from sequencing the N-terminus of Tth111II <400> SEQUENCE: 23 Met Ser Asn Trp Ile Asp Leu Tyr Thr His Leu Lys Gln Glu Val Pro 1 5 10 15 Trp Phe Phe Asn 20 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 24 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: primers <400> SEQUENCE: 24 ggtggtggat ccaaytggat hgayctntay ac 32 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 25 <211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM: Thermus thermophilus 111 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: R = A or G <400> SEQUENCE: 25 ggtggtggat ccrttraara accanggnac ytcytg 36 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 26 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: primer <400> SEQUENCE: 26 acccatctaa aacargtncc ntggtt 26 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 27 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: unknown <220> FEATURE: <223> OTHER INFORMATION: primer <400> SEQUENCE: 27 tgttttagat gggtrtanag rtcdatcca 29 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 28 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: primer <400> SEQUENCE: 28 accggactct acgagaggtt gcgc 24 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 29 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: primer <400> SEQUENCE: 29 gtcggcatgg agggcatcgg ccag 24 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 30 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: unknown <220> FEATURE: <223> OTHER INFORMATION: primer <400> SEQUENCE: 30 ggacaggaac ggaccgcatg gtgg 24 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 31 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: primer <400> SEQUENCE: 31 tagcgcctga agccggaacg ctcc 24 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 32 <211> LENGTH: 69 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: primers <400> SEQUENCE: 32 ggtggttcta gaaataattt tgtttaactt taaggaggta aatagaactg gatcgatctt 60 tacacccat 69 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 33 <211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM: unknown <220> FEATURE: <223> OTHER INFORMATION: primer <400> SEQUENCE: 33 ggtggtggat ccctaccccc gcaactcctc caaact 36 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 34 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: mutant copy <400> SEQUENCE: 34 gtggatcgat cttt 14

* * * * *

Field of search:


Other references:

Roberts and Macelis, Nucl. Acids Res. 27:312-313 (1999). Roberts and Macelis, Nucl. Acids Res. 27:312-313 (1999).
Kosykh et al., Mol. Gen. Genet. 178: 717-719, (1980). Kosykh et al., Mol. Gen. Genet. 178: 717-719, (1980).
Mann et al., Gene 3: 97-112, (1978). Mann et al., Gene 3: 97-112, (1978).
Walder et al., Proc. Natl. Acad. Sci. 78: 1503-1507, (1981). Walder et al., Proc. Natl. Acad. Sci. 78: 1503-1507, (1981).
Bougueleret et al., Nucl. Acids Res. 12: 3659-3676, (1984). Bougueleret et al., Nucl. Acids Res. 12: 3659-3676, (1984).
Gingeras and Brooks, Proc. Natl. Acad. Sci. USA 80: 402-406, (1983). Gingeras and Brooks, Proc. Natl. Acad. Sci. USA 80: 402-406, (1983).
Theriault and Roy, Gene 19: 355-359 (1982). Theriault and Roy, Gene 19: 355-359 (1982).
Blumenthal et al., J. Bacteriol. 164: 501-509, (1985). Blumenthal et al., J. Bacteriol. 164: 501-509, (1985).
Wayne et al. Gene 202: 83-88, (1997). Wayne et al. Gene 202: 83-88, (1997).
Kiss et al., Nucl. Acids Res. 13: 6403-6421, (1985). Kiss et al., Nucl. Acids Res. 13: 6403-6421, (1985).
Szomolanyi et al., Gene 10: 219-225, (1980). Szomolanyi et al., Gene 10: 219-225, (1980).
Janulaitis et al., Gene 20: 197-204 (1982). Janulaitis et al., Gene 20: 197-204 (1982).
Kiss and Baldauf, Gene 21: 111-119, (1983). Kiss and Baldauf, Gene 21: 111-119, (1983).
Walder et al., J. Biol. Chem. 258: 1235-1241, (1983). Walder et al., J. Biol. Chem. 258: 1235-1241, (1983).
Fomenkov et al., Nucl. Acids Res. 22: 2399-2403, (1994). Fomenkov et al., Nucl. Acids Res. 22: 2399-2403, (1994).
Malone et al., J. Mol. Biol. 253: 618-632, (1995). Malone et al., J. Mol. Biol. 253: 618-632, (1995).
New England Biolabs' Catalog, 2000-01, p. 220. New England Biolabs' Catalog, 2000-01, p. 220.
Matsudaira, J. Biol. Chem., 262:10035-10038 (1987). Matsudaira, J. Biol. Chem., 262:10035-10038 (1987).
Waite-Reese, et al., J. Bacteriology, 173:5207-5219 (1991). Waite-Reese, et al., J. Bacteriology, 173:5207-5219 (1991).

References:




Browse by classes

Advertisements

© 2013 Patentsmania.com | viewweather.com | tubelyrics.org | lyricsinfo.org | getacd.es | getamovie.org | getalyric.com | carpati.org | getamap.net | ro | 0.9401s