Home
Agents
Assignees
Inventors
Examiners
Contact
Links

Cloning and expression of the human macrophage inflammatory protein-1.alpha . α) /rantes receptor


No:

5652133 -

Application no:

08012988 -

Filed date:

1993-01-28 -

Issue date:

1997-07-29



Abstract:


This invention provides for the cloning and expression of the human Macrophage Inflammatory Protein-1α (MIP-1α)/RANTES Receptor. This receptor binds two cytokines MIP-1α and RANTES which are pro-inflammatory cytokines. The receptor is useful for assaying the levels of these cytokines in biological specimens. These cytokines play key roles in the inflammatory processes afflicting man.

US Classes:



Inventors:



Agents:


Assignees:


Claims:


What is claimed is:

1. A substantially purified nucleic acid encoding a receptor for macrophage inflammatory protein-1α (MIP-1α) and regulated upon activation normal T expressed and secreted (RANTES) protein said nucleic acid capable of selectively hybridizing to a second nucleic acid consisting of the complement of the nucleotide sequence of Sequence I.D. No. 1 in the presence of a human genomic library under stringent conditions of 68° C. and 0.1× SSC or SSPE.

2. A substantially purified nucleic acid of claim 1 encoding the polypeptide of Sequence I.D. No. 2.

3. A subsequence of the nucleic acid of claim 1 having at least 12 contiguous nucleotides, said nucleic acid capable of selectively hybridizing to a second nucleic acid consisting of the complement of the nucleotide sequence of Sequence I.D. No. 1 in the presence of a human genomic library under stringent conditions of 68° C. and 0.1× SSC or SSPE.

4. A substantially purified nucleic acid of claim 1, wherein a promoter is operably linked to the nucleic acid.

5. A nucleic acid of claim 4, wherein the promoter and the nucleic acid are contained in an expression vector.

6. A cell transformed or transfected with a nucleic acid of claim 5.

7. A cell transformed or transfected with a nucleic acid of claim 1.

8. A cell of claim 7, wherein the cell is mammalian.

9. A cell of claim 8 wherein the cell is expressing the MIP-1α/RANTES receptor gene product and transporting the product in a biologically active form to its plasma membrane.

10. A substantially purified polypeptide having an amino acid sequence substantially identical to a polypeptide of Sequence I.D. No. 2.

11. A substantially purified nucleic acid wherein said nucleic acid consists of the nucleotide sequence of Sequence I.D. No. 1.

12. A substantially purified polypeptide consisting of the amino acid sequence of Sequence I.D. No. 2.


Text:


BACKGROUND OF THE INVENTION

This invention provides for the cloning and expression of the human Macrophage Inflammatory Protein-1α (MIP-1α)/RANTES Receptor. This receptor binds two cytokines MIP-1α and RANTES which are pro-inflammatory cytokines. The receptor is useful for assaying the levels of these cytokines in biological specimens. These cytokines play key roles in the inflammatory processes afflicting man.

The chemokine β division of the platelet factor 4 superfamily is comprised of at least six distinct cytokines that regulate trafficking of phagocytes and lymphocytes in mammalian species; at least one of these, MIP-1α also possesses anti-proliferative activity for hematopoietic stem cells. MIP-1α and the related β chemokine, RANTES, induce transient alterations in intracellular Ca2+ concentration in neutrophils that can be reciprocally and specifically desensitized, suggesting a common receptor. This invention provides both the cDNA and the gene for this receptor. The receptor is a member of the G protein-coupled receptor superfamily. It has .about. 33% amino acid identity with receptors for the α chemokine, interleukin-8, and may be the human homologue of the product of US28, an open reading frame of human cytomegalovirus.

The platelet factor 4 cytokine superfamily is comprised of structurally and functionally related 8-10 kilodalton peptides that are the products of distinct genes clustered on human chromosomes 4 and 17. The superfamily was named after the first member to be characterized. These peptides have been collectively designated as "chemokines" because of their hybrid activities: they regulate the trafficking and activation of lymphocytes and phagocytes of the mammalian immune system, but in addition, some are able to regulate the proliferative potential of hematopoietic progenitor cells, endothelial cells, and certain types of transformed cells (for reviews see Wolpe and Cerami, FASEB J. 3, 2565-2573 (1989); Oppenheim et al., Immunol. 9, 617-648 (1991); Schall, Cytokine 3, 165-183 (1991)). Thus, the chemokines are thought to play an important role in host defense against infection, in the pathogenesis of chronic inflammatory disorders, and in wound healing.

A structural signature common to all chemokines is the presence of four conserved cysteine residues. The chemokines can be divided into two groups, α and β, by the arrangement of the first two of these cysteines. Members of the chemokine α group all possess a single amino acid of variable identity interposed between the first two cysteines, the so-called "C--X--C" motif. The human chemokine α family includes platelet factor 4, interleukin-8/neutrophil activating peptide-1 (IL-8), GROα/melanoma growth stimulatory activity (GROα/MGSA), neutrophil activating peptide-2 (NAP-2), and other less well-characterized molecules. In general, members of this group are potent chemoattractants for neutrophils in vivo and in vitro; IL-8 and platelet factor 4 also regulate angiogenesis. (Koch et al., Science 258, 1798-1801 (1992); Maione et al., Science 247, 77-79 (1990)). Two human chemokine α receptors, designated IL-8 receptors A and B, have been identified; their structures are 77% identical at the amino acid level. IL-8 receptor B is a receptor for IL-8, NAP-2 and GROα/MGSA (Murphy and Tiffany, Science 253, 1280-1283 (1991); Lee et al., J. Biol. Chem. 267, 16283-16287 (1992)) whereas IL-8 receptor A is more selective for IL-8 (Holmes et al., Science 253, 1278-1280 (1991); Lee et al., J. Biol. Chem. 267, 16283-16287 (1992)). Signal transduction by both receptor subtypes leads to a rapid rise in the intracellular concentration of Ca2+.

In contrast, the first two conserved cysteines of all members of the chemokine β group are adjacent, the "C--C" motif. Members of this group attract and activate neutrophils, eosinophils, monocytes, macrophages and lymphocytes with variable selectivity. The human chemokine β family includes MIP-1α (Macrophage Inflammatory Protein-1α), MIP-1β, RANTES (Regulated on Activation, Normal T Expressed and Secreted), MCP-1 (Monocyte Chemoattractant Protein-1), MCP-2, MCP-3 and I-309. Of these, the biological properties of MIP-1α, RANTES and MCP-1 have been the most characterized.

Murine MIP-1 was originally purified from supernatants of endotoxin-activated macrophages as a complex of MIP-1α and MIP-1β which are 67% identical in amino acid sequence (Wolpe et al., J. Exp. Med. 167, 570-581 (1988); Davatelis et al., J. Exp. Med. 167, 1939-1944 (1988); Sherry et al., J. Exp. Med. 168, 2251-2259 (1988)).

In addition to being a chemoattractant for neutrophils (Wolpe et al., J. Exp. Med. 167, 570-581 (1988); Saukkonen et al., J. Exp. Med. 171, 439-448 (1990)), murine MIP-1 is a prostaglandin-independent endogenous pyrogen, has autocrine effects on macrophages, and may be involved in wound healing (Davatelis et al., Science 243, 1066-1068 (1989); Fahey et al., J. Immunol. 148, 2764-2769 (1992); Fahey et al., Cytokine 2, 92-98 (1990)). Many if not all of these effects are due to MIP-1α. In addition, MIP-1α suppresses proliferation of hematopoietic stem cells (Graham et al., Nature 344, 442-444 (1990); Broxmeyer et al., Blood 76, 1110-1116 (1990); Broxmeyer et al., J. Immunol. 147, 2586-2594 (1991); Dunlop et al., Blood 79, 2221-2225 (1992)). For this reason it has been suggested that MIP-1α may be a useful cytoprotective agent for clinical radiotherapy and chemotherapy of neoplastic disease (Dunlop et al., Blood 79, 2221-2225 (1992)). Limited functional information for MIP-1α using the human ligand and human targets is available. High and low affinity binding sites have been reported for human MIP-1α on the human myeloid cell line U937 (Yamamura et ai., Int. J. Hematol. 55, 131-137 (1992)); in contrast, a single class of binding sites for murine MIP-1α was detected on murine T cell and macrophage cell lines (Oh et al., J. Immunol. 147, 2978-2983 (1991)).

RANTES attracts eosinophils, monocytes and "memory" T cells (CD4+ /CD45RO+). It is a weak chemoattractant for neutrophils (Kameyoshi et ai., J. Exp. Med. 176, 587-592 (1992); Schall et al., Nature 347, 669-671 (1990); Schall, Cytokine 3, 165-183 (1991)). Characterization of binding sites for RANTES has not yet been reported. MCP-1 is a potent and specific chemoattractant and activating factor for monocytes (reviewed in Matsushima and Oppenheim, Cytokine 1, 2-13(1989)). Binding sites have been detected for MCP-1 on human monocytes (Yoshimura and Leonard, J. Immunol. 145, 292-297 (1990)).

SUMMARY OF THE INVENTION

This invention provides for a substantially purified nucleic acid encoding a receptor for macrophage inflammatory protein-1α (MIP-1α) and reduced upon activation normal T expressed and secreted (RANTES) protein said nucleic acid having a sequence substantially identical to a nucleic acid of Sequence I.D. No. 1 or the corresponding RNA. This invention further provides for primers and probes specific for this nucleic acid which comprise at least 12 contiguous nucleotides. Said sequences are then compared with known sequences by computer to determine their specificity in the human genome.

These nucleic acids are useful for expression in recombinant hosts operably linked to a promoter which is part of an expression cassette. The expression typically occurs as part of an expression vector or plasmid. The vector is then transformed into a host cell, preferably a mammalian cell. Functional expression whereby the receptor in an active form is expressed and transported to the plasma membrane of a cell is also described herein.

In addition this invention provides for purified recombinantly produced MIP-1α and RANTES protein from the nucleic acids described herein.

This invention further provides for a method of detecting the presence, absence or amount of cytokines RANTES and MIP-1α in a sample such as a physiological specimen, said method comprising:

(i) transforming a mammalian cell with a nucleic acid encoding a receptor for macrophage inflammatory protein-1α (MIP-1α) and reduced upon activation normal T expressed and secreted (RANTES) protein said nucleic acid having a sequence substantially identical to a nucleic acid of Sequence I.D. No. 1;

(ii) culturing the cell under conditions permitting the expression of the receptor and its transport to the plasma membrane of the cell;

(iii) contacting the cell with a cytokine selected from the group consisting of RANTES and MIP-1α; and,

(iv) detecting the binding of the cytokines to the receptor. In preferred formats the cells are oocytes, the nucleic acid is either cDNA or cRNA and the detection step is by measuring calcium mobilization or direct assay of the cytokine on the plasma membrane.

In another embodiment, the invention provides for assays in which activated neutrophils or any other cell producing the MIP-1α/RANTES receptor are used. Said cells would rely upon endogenous genes for the production of the receptor. The methods for use of endogenous receptor containing cells are as described herein for the recombinantly transformed cells.

BRIEF DESCRIPTION OF THE FIGURES

FIGS. 1A-C. Signal transduction by the receptor. (A) This chart presents evidence that the described cDNA encodes a receptor selective for an intercrine β ligand. (B) This chart provides concentration dependence for MIP-1α calcium mobilizing activity. (C) This chart presents data evidencing that the MIP-1α receptor is also a receptor for RANTES.

FIGS. 2A-B. Binding of 125 I-labeled MIP-1α to oocytes injected with p4 cRNA. (A) Total (closed circles) and non-specific binding (open circles) was determined. (B) Competitive assays involving a MIP-aα radioligand. More specifically, oocyte injected with MIP-1α/RANTES cRNA were incubated with 100,000 cpm 125 I-labeled MIP-1α in the presence or absence of unlabeled MIP-1α.

DEFINITIONS

The phrase "nucleic acid sequence" refers to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. It includes both self-replicating plasmids, infectious polymers of DNA or RNA and non-functional DNA or RNA.

Nucleic acids, as used herein, may be DNA or RNA. Additionally, substantial nucleic acid sequence identity exists when a nucleic acid segment will hybridize under selective hybridization conditions, to a complement of another nucleic acid strand under stringent hybridization conditions. Thus a given sequence can be varied to a minor degree and without effecting its ability to bind to a predetermined target. Typically a nucleic acid will hybridize to other sequences that are almost identical if the stringency conditions are reduced. The sequences of this invention are considered substantially identical if the sequences are able to bind under the following highly stringent conditions: 68° C. and 0.1× SSC or SSPE. Typically this means that the sequences are at least 75% homologous. However, when the signals are at optimum levels, one is assured that the sequences are essentially identical having about 90% homology. Thus, the invention provides for orthologous non-human MIP-1α/RANTES receptors.

The phrase "calcium mobilization" refers to the release of calcium ions from intracellular stores into the cytoplasm. This is often accompanied by an influx of calcium ions from the extracellular fluid (environment) into the cytoplasm. The final event is the pumping of cytoplasmic calcium into the extracellular fluid which is known as efflux and measured by release of radioactive calcium or by fluorescent means.

The term "complementary" means that one nucleic acid is identical to, or hybridizes selectively to, another nucleic acid. Typically, selective hybridization will occur when there is at least about 55% identity over a stretch of at least 14-25 nucleotides, preferably at least about 65%, more preferably at least about 75%, and most preferably at least about 90%. See, M. Kanehisa Nucleic Acids Res. 12:203 (1984), incorporated herein by reference.

"Isolated" or "substantially pure", when referring to nucleic acids, refer to those that have been purified away from other cellular components or other contaminants, e.g., other cellular nucleic acids or proteins, by standard techniques, including alkaline/SDS treatment, CsCl banding, column chromatography, and others well known in the art. See, F. Ausubel, et aI., ed. Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, New York (1987), incorporated herein by reference.

"Nucleic acid probes" may be DNA fragments prepared, for example, by PCR as discussed above, or synthesized by either the phosphoramidite method described by Beaucage and Carruthers, Tetrahedron Lett. 22:1859-1862 (1981), or by the triester method according to Matteucci, et al., J. Am. Chem. Soc., 103:3185 (1981), both incorporated herein by reference. A double stranded fragment may then be obtained, if desired, by annealing the chemically synthesized single strands together under appropriate conditions or by synthesizing the complementary strand using DNA polymerase with an appropriate primer sequence. Where a specific nucleic acid sequence is given, it is understood that the complementary strand is also identified and included. The complementary strand will work equally well in situations where the target is a double stranded nucleic acid.

A nucleic acid probe is complementary to a target nucleic acid when it will anneal only to a single desired position on that target nucleic acid under conditions described herein. Proper annealing conditions depend, for example, upon a probe's length, base composition, and the number of mismatches and their position on the probe, and must often be determined empirically. For discussions of nucleic acid probe design and annealing conditions, see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989) or Current Protocols in Molecular Biology, F. Ausubel et al., ed. Greene Publishing and Wiley-Interscience, New York (1987), both of which are incorporated herein by reference.

The term "promoter" refers to a region of DNA upstream from the structural gene and involved in recognition and binding RNA polymerase and other proteins to initiate transcription.

The term "operably linked" refers to functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates transcription of RNA corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.

Techniques for nucleic acid manipulation, such as subcloning nucleic acid sequences encoding polypeptides into expression vectors, labelling probes, DNA hybridization, and so on are described generally, for example in Sambrook et al. (1989) op. cit., or Ausubel et al., ed. (1987) op. cit., both of which are incorporated herein by reference.

"Expression vectors", "cloning vectors", or "vectors" are often plasmids or other nucleic acid molecules that are able to replicate in a chosen host cell. Expression vectors may replicate autonomously, or they may replicate by being inserted into the genome of the host cell, by methods well known in the art. Vectors that replicate autonomously will have an origin of replication or autonomous replicating sequence (ARS) that is functional in the chosen host cell(s). Often, it is desirable for a vector to be usable in more than one host cell, e.g., in E. coli for cloning and construction, and in a mammalian cell for expression.

The phrase, "MIP-1α/RANTES receptor" refers to the gene product encoded by Seq. I.D. No. 1 and includes naturally occurring polymorphic variants in human and non-human populations which would be detectable using the given sequence as hybridization probe. In addition the term includes minor or conservative substitutions, deletions and additions to the primary amino acid sequence which do not significantly alter the biological properties of the native protein. Such changes would include substitutions of amino acids having similar chemical properties such as aspartic acid for glutamic acid or lysine for arginine and the like.

The terms "peptide", "polypeptide" or "protein" are used interchangeably herein. The term "substantial identity", when referring to polypeptides, indicates that the polypeptide or protein in question is at least about 70% identical to an entire naturally occurring protein (native) or a portion thereof, and preferably at least about 95% identical. Thus, the invention embraces orthologous non-human MIP-1α/RANTES receptors.

As used herein, the terms "isolated" and "substantially pure" are used interchangeably and describe a protein that has been separated from components which naturally accompany it. Typically, a monomeric protein is substantially pure when at least about 60 to 75% of a sample exhibits a single polypeptide backbone. Minor variants or chemical modifications typically share the same polypeptide sequence. A substantially purified protein will typically comprise over about 85 to 90% of a protein sample, more usually about 95%, and preferably will be over about 99% pure. Protein purity or homogeneity may be indicated by a number of means well known in the art, such as polyacrylamide gel electrophoresis of a protein sample, followed by visualizing a single polypeptide band on a polyacrylamide gel upon staining. For certain purposes high resolution will be needed and HPLC or a similar means for purification utilized.

A polypeptide is substantially free of naturally-associated components when it is separated from the native contaminants which accompany it in its natural state. Thus, a polypeptide which is chemically synthesized or synthesized in a cellular system different from the cell from which it naturally originates will be substantially free from its naturally-associated components.

DETAILED DESCRIPTION

An isolated nucleic acid sequence, termed MIP-1α/RANTES receptor and the novel polypeptide which it encodes are described herein. Under stringent hybridization conditions, the intact isolated nucleic acids of this invention, particularly seq. I.D. No. 1, can be used as a probe to identify other mammalian MIP-1α/RANTES receptors. Under these conditions, the sequence does not cross-hybridize to non MIP-1α/RANTES receptor genes.

The nucleic acid compositions of this invention, whether RNA, cDNA, genomic DNA, or a hybrid of the various combinations, may be isolated from natural sources or may be synthesized in vitro. The preferred source for the MIP-1α/RANTES receptor gene is a human genomic library such as from livers, as available from Stratagene (La Jolla, Calif.).

The nucleic acids claimed may be present in transformed or transfected whole cells, in a transformed or transfected cell lysate, or in a partially purified or substantially pure form.

Nucleic acid probes are also included in the claimed invention. Such probes are useful for detecting the presence of MIP-1α/RANTES receptor in physiological samples, and as primers for gene amplification. The nucleic acid probes will usually be at least about 20 nucleotides in length, more typically they will be more than 500 nucleotides in length.

A method of isolating the MIP-1α/RANTES receptor is also described herein. Briefly, the nucleic acid sequences can be isolated by probing a DNA library which is comprised of either genomic DNA or cDNA. Libraries may be either from commercial sources or prepared from mammalian tissue by techniques known to those skilled in the art. The preferred cDNA libraries are human cDNA libraries derived from B cells or neutrophils which are available from commercial sources. These receptors are also found in non-human species, e.g. mammals. For non-human orthologous receptors, one probes the appropriate library.

The DNA libraries can be probed by plaque hybridization using nucleic acid probes of at least 20 base pairs which are complementary to unique sequences of the MIP-1α/RANTES receptor gene. A preferred probe is about 626 bases binding to base 259 to base 884 of Seq. I.D. No.1. The probes are labeled to facilitate isolation of the hybridized clones. Labeling can be by any of the techniques known to those skilled in the art. Typically the longer probes are labeled with 32 P using Klenow.

Alternatively, using the sequences provided herein, those of skill may use polymerase chain reaction technology (PCR) to amplify nucleic acid sequences of the MIP-1α/RANTES receptor gene directly from mRNA, from cDNA, from genomic libraries or cDNA libraries. Polymerase chain reaction (PCR) or other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of MIP-1α/RANTES receptor in physiological samples, for nucleic acid sequencing, or for other purposes. Appropriate primers and probes for identifying MIP-1α/RANTES receptor from alternative mammalian tissues are generated from comparisons of the sequences provided herein. For a general overview of PCR see PCR Protocols: A Guide to Methods and Applications. (Innis, M, Gelfand, D., Sninsky, J. and White, T., eds.), Academic Press, San Diego (1990), incorporated herein by reference.

In summary, the MIP-1α/RANTES receptor gene can prepared by probing or amplifying selected regions of a mixed cDNA or genomic pool using the probes and primers generated from the sequences provided herein.

Through the use of recombinant DNA techniques one may express the MIP-1α/RANTES receptor gene in yeast, filamentous fungal cells, insect (especially employing baculoviral vectors), mammalian cells, and in bacterial systems. For this purpose, the natural or synthetic nucleic acids included in the invention will typically be operably linked to a promoter (which is either constitutive or inducible), and may be incorporated into an expression vector.

The isolated nucleic acid sequences can then be inserted into a cloning vector suitable for replication and integration in either prokaryotes or eukaryotes. The cloning vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the MIP-1α/RANTES receptor gene. The vectors are comprised of expression cassettes containing at least one independent terminator sequence, sequences permitting replication of the plasmid in both eukaryotes and prokaryotes, i.e., shuttle vectors, and selection markers for both prokaryotic and eukaryotic systems.

Methods for the expression of cloned genes in bacteria are well known. To obtain high level expression of a cloned gene in a prokaryotic system, it is essential to construct expression vectors which contain, at a minimum, a strong promoter to direct mRNA transcription. The inclusion of selection markers in DNA vectors transformed in E. coli is also useful. Examples of such markers include genes specifying resistance to ampicillin, tetracycline, or chloramphenicol. See Sambrook for details concerning selection markers and promoters for use in E. coli.

It is expected that those of skill in the art are knowledgeable in the expression systems chosen for expression of the MIP-1α/RANTES receptor gene and no attempt to describe in detail the various methods known for the expression of proteins in eukaryotes will be made.

Suitable eukaryote hosts may include plant cells, insect cells, mammalian cells, yeast, filamentous fungi, or preferably, bacteria (e.g., E. coli or B. subtilis).

The protein encoded by the MIP-1α/RANTES receptor gene which is produced by recombinant DNA technology may be purified by standard techniques well known to those of skill in the art. Standard techniques include selective precipitation with such substances as ammonium sulfate, column chromatography, immunopurification methods, and others. See, for instance, R. Scopes, Protein Purification: Principles and Practice, Springer-Verlag: New York (1982), incorporated herein by reference.

Alternatively and preferably, fusion proteins produced by the above method may be purified by a combination of sonication and affinity chromatography. Subsequent digestion of the fusion protein with an appropriate proteolytic enzyme releases the desired polypeptide.

The MIP-1α/RANTES receptor gene appears in the human population in various forms. By following the methods disclosed herein, one can evaluate the polymorphisms. The invention describes a single sequence encoding MIP-1α/RANTES receptor. Polymorphic forms are also intended to be included. These forms are obtained by using the given sequence as probe under stringent conditions to assay a genomic library. Polymorphic variants of the MIP-1α/RANTES receptor genes are obtained by comparing the sequences of other genes hybridizing to the original sequence.

The present invention also provides methods for detecting the presence or absence of MIP-1α/RANTES receptor in a physiological specimen.

One method involves a Southern transfer and is well known to those of skill in the art. Briefly, the digested genomic DNA is run on agarose slab gels in buffer and transferred to membranes. Hybridization is carried out using the probes discussed above. Visualization of the hybridized portions allows the qualitative determination of the presence or absence of MIP-1α/RANTES receptor.

Similarly, a Northern transfer may be used for the detection of MIP-1α/RANTES receptor in samples of RNA. This procedure is also well known in the art. See, Maniatis, et al., Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982). In brief, the mRNA is isolated from a given cell sample using an acid guanidinium-phenol-chloroform extraction method. The mRNA is then electrophoresed to separate the mRNA species and the mRNA is transferred from the gel to a nitrocellulose membrane. As with the Southern blots, labeled probes are used to identify the presence or absence of the MIP-1α/RANTES receptor transcript.

An alternative means for determining the level of expression of the MIP-1α/RANTES receptor gene is in situ hybridization. In an in situ hybridization cells are fixed to a solid support, typically a glass slide. If DNA is to be probed the cells are denatured with heat or alkali. The cells are then contacted with a hybridization solution at a moderate temperature to permit annealing of MIP-1α/RANTES receptor specific probes that are labelled. The probes are preferably labelled with radioisotopes or fluorescent reporters. In situ hybridization assays are well known and are generally described in Angerer, et al., Methods Enzymol., 152:649-660 (1987).

In addition to the detection of MIP-1α/RANTES receptor using nucleic acid hybridization technology, one can use immunoassays to detect the MIP-1α/RANTES receptor gene product. Immunoassays can be used to qualitatively and quantitatively analyze the MIP-1α/RANTES receptor gene product. A general overview of the applicable technology can be found in Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Pubs., N.Y. (1988). In brief, the gene product or a fragment thereof is expressed in transfected cells, preferably bacterial cells, and purified as generally described above and in the examples. The product is then injected into a mammal capable of producing antibodies. Either monoclonal or polyclonal antibodies specific for the gene product can be used in various immunoassays. Such assays include ELISA, competitive immunoassays, radioimmunoassays, western blots, indirect immunofluorescent assays and the like.

Finally, the MIP-1α/RANTES receptor can be functionally expressed on the surface of mammalian cells and these cells used to directly assay for MIP-1α or RANTES in biological samples. The quantitation of MIP-1α or RANTES is useful for monitoring the levels of these cytokines in a patient. Such measurements are useful in following the anti-inflammatory effects of drugs and prospective usefulness of new anti-inflammatory agents.

Functional expression of eukaryote proteins is well known. The methods are as followed in typical transection protocols such as described in Sambrook. In brief, such assays are produced by transforming cells such as COS cells, 293 cells, 3T3 fibroblast cells, and yeast cells. Alternatively oocytes, typically from frogs can be microinjected with synthetic RNA (copy RNA). The cells are transformed with a suitable expression vector or a suitable amount of synthetic or copy RNA to effect expression of the MIP-1α/RANTES receptor on the cell's plasma membrane. The cells are then exposed to labelled MIP-1α or RANTES and the amount of binding assayed either by fluorescent microscopy or autoradiography. Alternatively, binding of MIP-1α or RANTES to the cells will result in a calcium efflux and this can be measured as described below.

Fluid samples from patients suffering from inflammatory diseases are taken using standard methods. These fluids include plasma, synovial fluid, abscess fluid, bronchopulmonary lavage fluid and the like. For example, synovial fluid from an arthritic joint could be assayed for the presence of elevated amounts of MIP-1α or RANTES. As the disease progresses or is abated by drug therapies, the relative amount of MIP-1α or RANTES will change and the concentration changes would be reflected in the binding assays described above.

The following examples are provided by way of illustration only and not by way of limitation. Those of skill will readily recognize a variety of noncritical parameters which could be changed or modified to yield essentially similar results.

EXAMPLES

Example 1: Screening a Genomic Library for the MIP-1α/RANTES Receptor

i. PCR Amplification of a MIP-1α/RANTES Probe

The DNA sequence encoding the MIP-1α/RANTES receptor may be isolated from a human genomic or cDNA library using a DNA probe specific to a portion of that sequence. A preferred probe encoding a 626 base pair portion of the coding block of the MIP-1α/RANTES receptor gene may be amplified by polymerase chain reaction (PCR) from human genomic DNA using a pair of primers corresponding to sequences from base 259 to 275 and from base 868 to 884 of sequence I.D. No. 1. The PCR reaction solution consists of 67 to 71 μl of water, 10 μl of 10× buffer, 8 μl dNTPs (10 mM stock concentration each for dATP, dCTP, dGTP, dTTP in a master mix, final concentration=2 mM each, Perkin-Elmer Cetus, Emeryville, Calif.), 5 μl each of 20 μM sense and antisense primer (final concentration each=1 μM), 1-5 μl DNA, and 1 μl Taq DNA polymerase (Boehringer-Mannheim, Indianappolis) to provide a total volume of 100 μl. The PCR conditions are 95° C. for 5 min; 30 cycles of 94° C. for 20 sec then 55° for 20 sec, and 72° C. for 1 min. Cycling occurs in a GeneAmp Thermocycler from Perkin Elmer/Cetus.

ii. Screening a Genomic Library

Using the above described probe, a human fetal liver genomic library (Stratagene, La Jolla, Calif.) is screened by plaque hybridization with a 32 P-labeled probe specific to a segment of the DNA encoding the MIP-1α/RANTES receptor. Hybridization occurs in a buffer containing 50% formamide, 5× SSPE, 0.5% SDS, 50 μg/ml denatured salmon sperm DNA and 106 cpm/ml of labeled probe at 37° C. for 20 hours. The filters are washed in 5× SSPE at 45° C. for 1 hour. Positive clones are then purified and their sequences verified in comparison with Seq. I.D. No. 1.

Example 2: Synthesis of MIP-1α/RANTES Receptor Protein cRNA

In our laboratory, the given sequence was identified and cloned without pre-knowledge of the actual sequence. From this sequence a copy RNA was produced and its ability to generate a suitably sized protein checked by in vitro synthesis. The cRNA was synthesized by in vitro transcription with T3 RNA polymerase of a Bluescript construct that had been cleaved with Xho I.

Example 3: Functional Expression and Calcium Efflux Assay

The materials and methods used for the calcium efflux assay were as described in Murphy, et al., J. Immunol. 145:2227-2234 (1990). Adult female laboratory bred Xenopus laevis (Nasco, Fort Atkinson, Wis.) were maintained at 19° C. to 22° C. in a light-dark cycle of 12 h per phase. The frogs were anesthetized and ovarian lobes were resected and defolliculated in OR2 solution (82.5 mM NaCl, 1 mM MgCl2, 2.4 mM KCl, 5 mM HEPES, pH 7.5) containing 2 mg/ml collagenase for 2 h on a rotary shaker. Stage V-VI oocytes were transferred to ND96 solution (96 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, 2.4 mM sodium pyruvate, penicillin 100 U/ml, streptomycin 100 μg/ml, 5 mM HEPES, pH 7.4 to 7.5).

After 1-2 days, oocytes were microinjected with RNA samples in a total volume of 50 nl per oocyte and were then incubated in ND96 solution at 20° C. to 23° C. for 3 to 5 days. Oocytes were then incubated in 500 μl of OR2 medium containing 45 Ca2+ [50 μCi/ml (ICN Biomedicals, Costa Mesa, Calif.)] for 3 hours at 20° C. After ten washes with ND96 medium, individual oocytes were stimulated with ligand in wells of a 96-well tissue culture plate containing 100 μl of ND96 medium. Three 100 μl samples of the incubation medium were collected and analyzed by liquid scintillation counting: a) the final 100 μl wash (20 min) before application of ligand; b) fluid containing the stimulus, removed after a 20 min incubation with the oocyte; and c) the oocyte solubilized in SDS (1%) in medium 20 min after stimulation. Data are presented as the mean±standard error of the mean (SEM) of the percent of loaded 45 Ca2+ that was released by individual oocytes in response to the stimulus, or [(b-a)÷(b+c)]×100.

Ligands were all human recombinant material obtained from the following sources: MIP-1α (R and D Systems, Minneapolis, Minn.); IL-8, RANTES, and MCAF (Genzyme, Cambridge, Mass.); NAP-2 (Bachem Bioscience, Philadelphia, Pa.); GRO-α (a gift from M. P. Beckmann, S. Lyman and D. Cerretti). MIP-1α and MIP-1β used in a ligand screen was a gift of U. Siebenlist (NIAID, Bethesda, Md.) and were used as a diluted supernatant of Sf9 insect cells expressing immunoreactive recombinant human MIP-1α (from clone pAT464) or MIP-1β (from clone pAT744) that was prepared as described in Zipfel et al. J. Immunol. 142:1582-1590 (1989) and Zipfel et al. Lymph. Cyto. Res. 11:141-148 (1992). All proteins were diluted from aqueous stock solutions or culture supernatants into ND96 oocyte media (96 mM NaCl, 1 mM KCl, 1 mM MgCl2. 1/8 mM CaCl2, pH 7.45) containing 0.1% bovine serum albumin.

Oocytes injected with cRNA acquired responsiveness to MIP-1α and RANTES, but not to MIP-1β, MCP-1, IL-8, GROα, or NAP-2 (FIG. 1).

More specifically the data presented in FIG. 1 demonstrates that a signal transduction is associated with the MIP-1α/RANTES receptor. (A) The MIP-1α/RANTES receptor cDNA encodes a receptor selective for an intercrine β ligand. Five days after injection with 10 ng of either MIP-1α/RANTES receptor cRNA (closed bars) or IL-8 receptor B cRNA (open bars), oocytes were stimulated with recombinant human IL-8, GRO-α or NAP-2 at 500 nM, or a 1:5 dilution of an Sf9 supernatant containing recombinant human MIP-1α or MIP-1β. Prostaglandin E2, histamine, C5a, f-met-leu-phe, ATP, UTP and platelet activating factor were also tested and were inactive. Neither MIPα nor MIP-1β activated the IL-8 receptor B. (B) Concentration dependence for MIP-1α calcium mobilizing activity. Oocytes injected with 50 ng HL-60 RNA (closed circle) or 10 ng of MIP-1α/RANTES receptor cRNA (open circle) were stimulated with the indicated concentration of recombinant human MIP-1α. (C) The MIP-1α receptor is also a receptor for RANTES. Oocytes were injected with either HL-60 RNA (open bars) or MIP-1α/RANTES receptor cRNA (closed bars) and stimulated with the indicated ligand at 250 nM. In panels A-C, the data derive from 5-8 replicate determinations per point. Basal amounts of calcium efflux and calcium uptake were similar for all experimental conditions.

From our studies, the EC50 for RANTES was approximately 50 nM. The oocyte response to MIP-1α had two phases, one that appeared to saturate at 100 NM MIP-1α, and a second that did not reach a plateau at 5000 nM MIP-1α.

Example 4: Radioligand Binding Assay

Carrier free recombinant human MIP-1α 10 μg (Genzyme, Cambridge, Mass.) was labeled using 5 mCi Na125 I (Amersham, Arlington Heights, Ill.) in 100 μl 0.2M sodium phosphate, pH 7.2 and 50 μl reconstituted Enzymobeads (BioRad, Richmond, AC). The reaction was started using 25 μl 1% β-D-glucose and allowed to continue for 20 minutes. Labeled sample was separated from the free iodine using a NAP-5 column (Pharmacia LKB, Piscataway, N.J.) which had been previously rinsed with 1% bovine serum albumin in 0.2M sodium phosphate, pH 7.2. Labeled material was collected from the column and analyzed on a 14% acrylamide gel. Single oocytes were incubated with 125 I-MIP-1α for 30 min on ice in 10 μl of binding buffer (Hanks' balanced salt solution with 25 mM HEPES, 1% bovine serum albumin, pH 7.4). Unbound ligand was removed by centrifugation of the oocyte through 300 μl of F50 silicone fluid (General Electric, Waterford, N.Y.). The tubes were quickly frozen and gamma emissions from the amputated tips were counted.

The results of the binding assays are presented in FIG. 2. Binding of 125 I-labeled MIP-1α to oocytes injected with MIP-1α/RANTES receptor cRNA. (A) Total (closed circles) and non-specific binding (open circles) was determined by incubating oocytes injected with MIP-1α/RANTES receptor cRNA with the indicated concentration of 125 I-labeled MIP-1α in the absence or presence of a 100 fold molar excess of unlabeled MIP-1α, respectively. Non-specific binding was subtracted from total binding to determine specific binding (open squares). Specific binding of 125 I-labeled MIP-1α to oocytes expressing IL-8 receptor B was undetectable. (B) Oocytes injected with MIP-1α/RANTES receptor cRNA were incubated with 100 nM 125 I-labeled MIP-1α in the presence or absence of the indicated concentration of unlabeled MIP-1α. One hundred percent represents a mean of 6401 cpm. Data are derived from triplicate determinations per point.

The threshold for detection of specific binding of 125 I-MIP-1α to oocytes injected with the MIP-1α/RANTES receptor cRNA was the same as that required for stimulation of calcium efflux. 125 I-MIP-1α did not bind specifically to oocytes expressing human IL-8R B.

________________________________________________________ __________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 2 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2156 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: primer-- bind (B) LOCATION: 259..275 (ix) FEATURE: (A) NAME/KEY: primer-- bind (B) LOCATION: complement (868..884) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 63..1128 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GGCACGAGCCCAGAAACAAAGACTTCACGGACAAAGTCCCTTGGAACCAGAGAGAAGCCG 60 GGATGGAAACTCCAAACACCACAGAGGACTATGACACGACCACAGAG107 MetGluThrProAsnThrThrGluAspTyrAspThrThrThrGlu 151015 TTTGACTATGGGGATGCAACTCCGTGCCAGAAGGTGAACGAGAGGGCC155 PheAspTyrGlyAspAlaThrProCysGlnLysValAsnGluArgAla 202530 TTTGGGGCCCAACTGCTGCCCCCTCTGTACTCCTTGGTATTTGTCATT203 PheGlyAlaGlnLeuLeuProProLeuTyrSerLeuValPheValIle 354045 GGCCTGGTTGGAAACATCCTGGTGGTCCTGGTCCTTGTGCAATACAAG251 GlyLeuValGlyAsnIleLeuValValLeuValLeuValGlnTyrLys 505560 AGGCTAAAAAACATGACCAGCATCTACCTCCTGAACCTGGCCATTTCT299 ArgLeuLysAsnMetThrSerIleTyrLeuLeuAsnLeuAlaIleSer 657075 GACCTGCTCTTCCTGTTCACGCTTCCCTTCTGGATCGACTACAAGTTG347 AspLeuLeuPheLeuPheThrLeuProPheTrpIleAspTyrLysLeu 80859095 AAGGATGACTGGGTTTTTGGTGATGCCATGTGTAAGATCCTCTCTGGG395 LysAspAspTrpValPheGlyAspAlaMetCysLysIleLeuSerGly 100105110 TTTTATTACACAGGCTTGTACAGCGAGATCTTTTTCATCATCCTGCTG443 PheTyrTyrThrGlyLeuTyrSerGluIlePhePheIleIleLeuLeu 115120125 ACGATTGACAGGTACCTGGCCATCGTCCACGCCGTGTTTGCCTTGCGG491 ThrIleAspArgTyrLeuAlaIleValHisAlaValPheAlaLeuArg 130135140 GCACGGACCGTCACTTTTGGTGTCATCACCAGCATCATCATTTGGGCC539 AlaArgThrValThrPheGlyValIleThrSerIleIleIleTrpAla 145150155 CTGGCCATCTTGGCTTCCATGCCAGGCTTATACTTTTCCAAGACCCAA587 LeuAlaIleLeuAlaSerMetProGlyLeuTyrPheSerLysThrGln 160165170175 TGGGAATTCACTCACCACACCTGCAGCCTTCACTTTCCTCACGAAAGC635 TrpGluPheThrHisHisThrCysSerLeuHisPheProHisGluSer 180185190 CTACGAGAGTGGAAGCTGTTTCAGGCTCTGAAACTGAACCTCTTTGGG683 LeuArgGluTrpLysLeuPheGlnAlaLeuLysLeuAsnLeuPheGly 195200205 CTGGTATTGCCTTTGTTGGTCATGATCATCTGCTACACAGGGATTATA731 LeuValLeuProLeuLeuValMetIleIleCysTyrThrGlyIleIle 210215220 AAGATTCTGCTAAGACGACCAAATGAGAAGAAATCCAAAGCTGTCCGT779 LysIleLeuLeuArgArgProAsnGluLysLysSerLysAlaValArg 225230235 TTGATTTTTGTCATCATGATCATCTTTTTTCTCTTTTGGACCCCCTAC827 LeuIlePheValIleMetIleIlePhePheLeuPheTrpThrProTyr 240245250255 AATTTGACTATACTTATTTCTGTTTTCCAAGACTTCCTGTTCACCCAT875 AsnLeuThrIleLeuIleSerValPheGlnAspPheLeuPheThrHis 260265270 GAGTGTGAGCAGAGCAGACATTTGGACCTGGCTGTGCAAGTGACGGAG923 GluCysGluGlnSerArgHisLeuAspLeuAlaValGlnValThrGlu 275280285 GTGATCGCCTACACGCACTGCTGTGTCAACCCAGTGATCTACGCCTTC971 ValIleAlaTyrThrHisCysCysValAsnProValIleTyrAlaPhe 290295300 GTTGGTGAGAGGTTCCGGAAGTACCTGCGGCAGTTGTTCCACAGGCGT1019 ValGlyGluArgPheArgLysTyrLeuArgGlnLeuPheHisArgArg 305310315 GTGGCTGTGCACCTGGTTAAATGGCTCCCCTTCCTCTCCGTGGACAGG1067 ValAlaValHisLeuValLysTrpLeuProPheLeuSerValAspArg 320325330335 CTGGAGAGGGTCAGCTCCACATCTCCCTCCACAGGGGAGCATGAACTC1115 LeuGluArgValSerSerThrSerProSerThrGlyGluHisGluLeu 340345350 TCTGCTGGGTTCTGACTCAGACCATAGGAGGCCAACCCAAAATAAGCAGGCGT1168 SerAlaGlyPhe 355 GACCTGCCAGGCACACTGAGCCAGCAGCCTGGCTCTCCCAGCCAGGTTCTGACTCTTGGC 1228 ACAGCATGGAGTCACAGCCACTTGGGATAGAGAGGGAATGTAATGGTGGCCTGGGGCTTC 1288 TGAGGCTTCTGGGGCTTCAGTCTTTTCCATGAACTTCTCCCCTGGTAGAAAGAAGATGAA 1348 TGAGCAAAACCAAATATTCCAGAGACTGGGACTAAGTGTACCAGAGAAGGGCTTGGACTC 1408 AAGCAAGATTTCAGATTTGTGACCATTAGCATTTGTCAACAAAGTCACCCACTTCCCACT 1468 ATTGCTTGCACAAACCAATTAAACCCAGTAGTGGTGACTGTGGGCTCCATTCAAAGTGAG 1528 CTCCTAAGCCATGGGAGACACTGATGTATGAGGAATTTCTGTTCTTCCATCACCTCCCCC 1588 CCCCCGCCACCCTCCCACTGCCAAGAACTTGGAAATAGTGATTTCCACAGTGACTCCACT 1648 CTGAGTCCCAGAGCCAATCAGTAGCCAGCATCTGCCTCCCCTTCACTCCCACCGCAGGAT 1708 TTGGGCTCTTGGAATCCTGGGGAACATAGAACTCATGACGGAAGAGTTGAGACCTAACGA 1768 GAAATAGAAATGGGGGAACTACTGCTGGCAGTGGAACTAAGAAAGCCCTTAGGAAGAATT 1828 TTTATATCCACTAAAATCAAACAATTCAGGGAGTGGGCTAAGCACGGGCCATATGAATAA 1888 CATGGTGTGCTTCTTAAAATAGCCATAAAGGGGAGGGACTCATCATTTCCATTTACCCTT 1948 CTTTTCTGACTATTTTTCAGAATCTCTCTTCTTTTCAAGTTGGGTGATATGTTGGTAGAT 2008 TCTAATGGCTTTATTGCAGCGATTAATAACAGGCAAAAGGAAGCAGGGTTGGTTTCCCTT 2068 CTTTTTGTTCTTCATCTAAGCCTTCTGGTTTTATGGGTCAGAGTTCCGACTGCCATCTTG 2128 GACTTGTCAGCAAAAAAAAAAAAAAAAA2156 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 355 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: MetGluThrProAsnThrThrGluAspTyrAspThrThrThrGluPhe 151015 AspTyrGlyAspAlaThrProCysGlnLysValAsnGluArgAlaPhe 202530 GlyAlaGlnLeuLeuProProLeuTyrSerLeuValPheValIleGly 354045 LeuValGlyAsnIleLeuValValLeuValLeuValGlnTyrLysArg 505560 LeuLysAsnMetThrSerIleTyrLeuLeuAsnLeuAlaIleSerAsp 65707580 LeuLeuPheLeuPheThrLeuProPheTrpIleAspTyrLysLeuLys 859095 AspAspTrpValPheGlyAspAlaMetCysLysIleLeuSerGlyPhe 100105110 TyrTyrThrGlyLeuTyrSerGluIlePhePheIleIleLeuLeuThr 115120125 IleAspArgTyrLeuAlaIleValHisAlaValPheAlaLeuArgAla 130135140 ArgThrValThrPheGlyValIleThrSerIleIleIleTrpAlaLeu 145150155160 AlaIleLeuAlaSerMetProGlyLeuTyrPheSerLysThrGlnTrp 165170175 GluPheThrHisHisThrCysSerLeuHisPheProHisGluSerLeu 180185190 ArgGluTrpLysLeuPheGlnAlaLeuLysLeuAsnLeuPheGlyLeu 195200205 ValLeuProLeuLeuValMetIleIleCysTyrThrGlyIleIleLys 210215220 IleLeuLeuArgArgProAsnGluLysLysSerLysAlaValArgLeu 225230235240 IlePheValIleMetIleIlePhePheLeuPheTrpThrProTyrAsn 245250255 LeuThrIleLeuIleSerValPheGlnAspPheLeuPheThrHisGlu 260265270 CysGluGlnSerArgHisLeuAspLeuAlaValGlnValThrGluVal 275280285 IleAlaTyrThrHisCysCysValAsnProValIleTyrAlaPheVal 290295300 GlyGluArgPheArgLysTyrLeuArgGlnLeuPheHisArgArgVal 305310315320 AlaValHisLeuValLysTrpLeuProPheLeuSerValAspArgLeu 325330335 GluArgValSerSerThrSerProSerThrGlyGluHisGluLeuSer 340345350 AlaGlyPhe 355
________________________________________________________ __________________


Field of search:

Primers No:24.33 - Primers
UNKNOWN No:240.2 - UNKNOWN

References:




Browse by classes

Advertisements

© 2013 Patentsmania.com | viewweather.com | tubelyrics.org | lyricsinfo.org | getacd.es | getamovie.org | getalyric.com | carpati.org | getamap.net | ro | 0.0380s